Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2364  (registered. 2012)
Contig Information
Length 973 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_PCDAM Anther at meiosis 9
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VABA Shoot with ABA treatment 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|17887465|gb|AAL40895.1|| phosphoethanolamine methyltransferase [Triticum aestivum]
Score 469
Evalue 2.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2364
AACTCCACAGTGACGAAGGCCACGTAGCAACAGAATAGCACGTTACAAAGCGAGTCTCGCTCGTCACAGTACAAGTTCAGGAATACAGTACGTACGTACG
TACACATTATCTTACAGATCCTGGTGCCCAGCCAGTGAATGCAGCCACTGCAACAAACAAACAATCACACCCAACACACGGCCACAACATTGTCGAGCAC
CGATCCTCTTTATTTATTTCTTAACAGAAGCTGCTCTGCTCCCGAATCATCGCGTCCATGGCGTCGCTGCTCAGCGGCCAGATCACTTGGTCGCGATGAA
CAGCCCCCACTTCTGCTCGCCGGCGGAGCTCCGCTTCAGCTTCGCGCTCCAGCCGTTGACGATGTCGTCGTAGTCCTCCTGGGTGAAGTCCGCCAGGAAG
GCCTCCTTGTTCTTCTCTGTCTCGCCCAGCTCCCTCTCCAGGACCCTCAGGAACTGGTCGGTGCGGTCTTCGGCGACAACATCGTGGAAACCGGCATCCT
CAAGCATCTTCCCATAGGTCTTCACATCATGGAGGTCATAGCCTCTCTGCTTGATGTACGCAGCGAATTCCTCTGATGGTGTGCCAGGGCTCCTGCAGTA
GTCACTGATCAGCACTTTGCCCCCAGGCTTGAGCCACTTGAAGAAGTTTCTGAACAGAGCAGGTTTGTCTTGGATGTGGAGGATGGTGTCACGGCTGTAG
ATGACATCAAACGTGTTCTCTGCATATTCCTTGGTGGTGCAGTCAGCAACCTCAAACTCAACCGAGCACGAGCGCCCGATGGCACGCTCGATCGCGAACG
AAACCATGTTGATGGAAAGATCGATGCCGAGGACATGGACATCATAGGTTTCAGCCATGTAGAAGTCGCCTCCTCCGATGCCACACCCAACATCGAGCAC
CTTCTGGCCAGCTTTCAGATCCAGCTTGTCCACAAATTCCTTTGTGGTCTCGAATCCACCGGTGCTAACATAA
page-top