Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23633  (registered. 2012)
Contig Information
Length 973 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|170795|gb|AAA50850.1|| wali5 [Triticum aestivum]
Score 192
Evalue 5.00E-47
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23633
GATCATTGTCGGTTGATTAGGATTTCCAGAAACCAAAGTTGGGAAGATTGAAGAATCCAAAACTCTCAATTTGCTGACTCCTCTGACTCTTCCATATTGA
TCAACAACAGCCAATGGATCAGAAGCAGGTCCCATCTTGCAAGTTCCGCAAGGATGAAAATCAGAGACAACAGAAGCCTTGATGATAGCAGCCAATTCAG
CATCAGTTTGAGCAGCCCATCCAGGAAAAATTTCATTTTCGACTGGTAAGGTAAAGTTGGTCAACAATGAGTTGTTCAACCACTTTCTAACTTGTCTAAT
TCCAAAGATAATTTCCAACAACAGAGAGCATTCTACCACCGCACCGCACGAGTGAAGTGAGAGCTTTGCACGAAAAGTTCATCAGCGACCATGAAGGGCA
CCAAGCTCGCGGCGATCCTCATCCTCCAGGCCGTCCTGGTCATGGGAGTCCTCTCACACGTGAACGCCGACTATTTCCCCAAGTGCTGCAACAACTGCAG
GTCCTTCTCCGGGGTCGACGTCTGCGACGACGCCCACCCCAAGTGCCCCAAGGGCTGCTCGGCGTGCCGCGTGGTGTCGACGAGCCCCGAAATGTGGCGC
TGCGCGGATATGAAATCCACCGTCGACGGCACCTGCGGTGGGCCCTGCAAGAAGTACTGATCGGCTCATGCCAGCATGATATGTTCCGCCTAAAATGAAA
TAAAAGCTCAGACGAGATGAGCAGCGTCATCGTGCCTATGCGTGTGTGTGTGGCCAACAAATATGTATACCAGTATGCCGTGTCTTCGTCGCTGTGTTTT
CTCTCTCGAGACTAGCAGTTGCGTCTTTGAGCCAATCAGTAGGAGCAGTATCTTCAGGACCAACAGTACATGGAAGTTCTACTCAAGCTTCTACTAGCTC
CACTAATCAGACTAAAGTTCCTCGTACTAAGAAGCGACCTGTTGCTGTTGCATCATCACTGAGATCTAATAAG
page-top