Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23617  (registered. 2012)
Contig Information
Length 701 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 4
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_PCDAM Anther at meiosis 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
WH_XA Root 2
WH_XB Root 4
WH_XD Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242062652|ref|XP_002452615.1|| hypothetical protein SORBIDRAFT_04g029160 [Sorghum bicolor]
Score 268
Evalue 5.00E-70
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23617
CCCACCTAAACCCGCGAAGTCACCAAGGCGGCGGCGGCGGCGGCGGCGGCAGCAGCAGCGGCGATGGGGAGCGACACGGAGACGGAGAAGAAGAAGACCC
CGGTGGCGCTGGCCCCCATCGCCAAGCCGCTCGCCGGCAAGAAGCTCTCCAAGAAAACCCTCAAGCTCGTTCGCCGAGCCTCGGAGGCCAAGTGCCTGAA
GCGCGGGGTCAAGGAGGTGGTCAAGAGCATCCGTCGTGGGAGCAAAGGGTTGTGTGTAATTGCCGGAAACATCTCTCCTATCGATGTGATTACACATCTT
CCCATACTTTGTGAGGAAGCTAATGTCCCATACATATATGTGGCATCAAAAGAGGAGCTTGCGACTGCGGGGACCACCAAGAGGCCCACCTGCTGCGTAT
TGGTGATGACCAAGCCAGCCAAGGGGGAGATCACTGAAGAGGTGAAGGAGAAACTGGAATCGGAATACAAGCAGGTTGTATCTGAAGTTGCTGAGGCTAC
ATCTGCTTTGTTCTGAGAACATTTCCATGGGGAGGAACCATGAATATCTTTCTGTCTGTATTATGTAGCATGATTTTGTCACCCTATCCTTGTTAGTGAT
CGACGTGTTTATCAGGCAGCTTTAAGCATCGTGAGTCTGGTACTGTGCTATTCGGTTGGCGATTAGATAAAAAAATAGTGCACTATTAACTAAAAAAAAA
A
page-top