Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2361  (registered. 2012)
Contig Information
Length 750 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 11
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 9
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|3334120|sp|P93594.1|AMYB_WHEAT|AMYB_WHEAT RecName: Full=Beta-amylase; AltName: Full=1,4-alpha-D-glucan"
Score 492
Evalue 2.00E-137
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2361
GAGTGAGTGAGCACGCAAGCCAGTGTTTGTAGCCAGCAGCCACAATGGCCGGGAACATGCTAGCCAACTATGTCCAAGTCTACGTCATGCTCCCGCTGGA
CGTCGTGAGCGTCGACAACAAATTCGAGAAGGGCGACGAGATCAGGGCGCAGCTGAAGAAGCTGACGGAGGCCGGCGTGGACGGCGTCATGATAGACGTC
TGGTGGGGGCTGGTGGAGGGCAAGGGCCCCAAGGCGTACGACTGGAGCGCCTACAAGCAGGTCTTCGACCTGGTGCACGAGGCCGGGCTCAAGCTGCAGG
CCATCATGTCATTCCACCAGTGCGGTGGCAACGTCGGCGACGTCGTCAACATCCCCATCCCACAGTGGGTTCGCGACGTCGGCGCCACCGACCCCGACAT
TTTCTACACCAACCGCGGCGGGACGAGGAACATCGAGTACCTCACCCTTGGAGTGGACGACCAGCCTCTCTTCCATGGAAGAACTGCCGTCCAGATGTAT
GCTGATTACATGGCGAGCTTCAGGGAAAACATGAAGAAGTTCTTGGATGCCGGTACCATCGTGGACATTGAAGTGGGACTTGGCCCAGCTGGAGAGATGA
GGTACCCATCGTATCCTCAGAGCCAAGGATGGGTCTTCCCAGGCATCGGAGAATTCATCTGTTATGATAAGTACCTGGAAGCAGACTTCAAAGCAGCAGC
GGCGAAGGCTGGCCACCCTGAGTGGGAATTGCCTGACGATGCTGGAGAGT
page-top