Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23558  (registered. 2012)
Contig Information
Length 1888 bp
Clones alternative view 64 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 3
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 5
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242061078|ref|XP_002451828.1|| hypothetical protein SORBIDRAFT_04g008330 [Sorghum bicolor]
Score 933
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23558
CTGCTCGTCGTCCCTCCAGTCCACCTACTTCGCACCGACCGATCCGATGGACCGCGCCGATCCCGCGCGGGGCCGCCTCGCCGTGCTCTCCTCCCACCTC
CTCGCCGCCGGCGCGGAACCCGCGGCCGCGCTGGAGAGGTCGCCGGCGTCGGCCGCGGCCCCGGGGACCCGCGCCGGCGTGCTCGCCGTGGTGGACTCGA
GGACCGGGAAGCGGTACGAGGTCAAGGTCTCGGAGGACGGCACCGTCCGCGCCACTGACTTCAAGAAGATTACCGCTGGAAAAGATGACAAGGGTCTTAA
GACTTATGATCCTGGTTATCTCAACACTGCCCCTGTGCGTTCTTCCATCTGCTACATTGATGGGGATGAGGGAATTCTTCGCTACAGGGGTTATCCAATT
GAGGAGGTTGCTGAAAGCAGTTCGTTTGTTGAGGTCGCCTACCTCTTAATGTATGGGAATTTGCCTTCTCAGAGTCAACTGGCAGCCTGGGAGTTTGCAA
TTTCACAGCACTCTGCTGTTCCTCAAGGACTCTTGGATATCATACAATCAATGCCTCATGATGCCCACCCCATGGGTGTCCTTGCCAGTGCAATGAGCAC
ACTTTCTGTCTTCCACCCAGATGCAAACCCTGCCCTTAGAGGGCAAGATCTGTACAACTCAAAGCAGGTTAGGGATAAGCAAATTGTGCGAGTTCTTGGG
AAGGCACCAGCAATAGCAGCTGCAGCCTACCTGAGACTAGCAGGAAGGCCTGCCGTCCTTCCTTCAAATAATCTTTCTTATTCAGAGAATTTCTTGTATA
TGCTAGACTCTTTGGGTGACAAAGAATATAAGCCAAATCCCCGACTTGCACGGGTTCTAGATATCCTTTTTATTCTCCATGCTGAACACGAAATGAACTG
CTCAACAGCTGCTGTTAGGCACCTTGCTTCAAGTGGTGTCGATGTCTTCACTGCTCTTTCTGGTGGTGTTGGAGCTCTATATGGTCCACTGCATGGTGGC
GCAAATGAGGCGGTACTTAAAATGTTGAATGAGATTGGAGCTGTGGAGAATATTCCAGATTTCATTGAGGGAGTGAAGAACAGGAAACGGAAAATGTCAG
GTTTTGGGCATCGTGTGTATAAGAATTATGATCCTCGCGCTAAAGTCATCCGGAAGTTAGCAGAAGAGGTTTTCTCGATTGTCGGACGGGATCCTCTTAT
CGAGGTTGCTGTTGCTTTGGAGAAGGCAGCACTGTCAGACGAGTATTTTATCAAGAGGAAGCTGTATCCAAATGTGGATTTTTACTCTGGCCTGATTTAC
AGAGCAATGGGATTCCCTACAGAATTTTTCCCTGTGTTATTTGCAATTCCTCGCATGGCTGGTTGGCTAGCACATTGGAAGGAGTCACTTGATGACCCAG
ACAATAAAATTATGAGGCCTCAACAGGTATATACGGGCGTTTGGCTGAGGCATTACACCCCTGTGAGGGAACGAGTGGCATCTAACCAGGGCGAGGAACT
TGGTCAGATCGCTACATCAAACGCGACGAGGCGTCGCCGTGCCGGTTCTTCCCTGTAGAACAACAGCACGCATGGATGCATGGTGCAGCATCCAGCCCAC
ACAATAAACCAAGCTGCTGTCCTTGCCACTCATAACGCCGCAGCGGCTTGAGACTGGGGGCGGTTACCCTTCTGGTGTCACCAAGACACTTAGCGGTTGC
CATGTAATAAAGTAGTAGTAGAAGGCACGCTGTGGACACTATCTATCCACGCACTTCCAGTTTCCAGCTTCATCTCTGCATGCATGCAATGTGAGCTCAT
GATTGGAAAAAATAAATCATACTCCCTTCGTCTCAAAATAAGTGTCTCAACTTTTGATGGCAAAAAGGTCTTCATAAGAGTGCACATA
page-top