Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23556  (registered. 2012)
Contig Information
Length 703 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218197039|gb|EEC79466.1|| hypothetical protein OsI_20483 [Oryza sativa Indica Group]
Score 241
Evalue 4.00E-62
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23556
CTCCTCTCACCGCACCGCGTCCCCTCCCTCTCCTGTCGCGTGCGCTCCGCCAGCAAAAGCTTCCACATAAGGACCAACAAGAGAAACCTTAATCTGTTCG
GTGCCAGTCAAACCTCAACAACAAAGTTTCATGTCTGATCTCGACGTTACTCTGCCATCTGCCTTCGATCCTTTTGCTGAGGCAAATGCTGAGGATGCTG
GTGCAGGCCCCGGCGCAAAAGATTATGTGCATGTGCGCATCCAGCAGCGCAACGGCAGGAAGAGTCTGACCACTGTCCAGGGCCTGAAGAAGGAGTTCAG
CTACAACAAGATCCTCAAGGATCTCAAGAAGGAATTCTGCTGCAATGGCACAGTAGTCCAGGATCCGGAGCTAGGCCAGGTCATTCAGCTTCAGGGTGAT
CAGCGTAAGAATGTTGCTACTTTCCTAGTCCAGGCTGGGATTGCGAAGAAGGAGCTCATCAAGATCCACGGCTTCTAAGCCTTAGCCGCCTCCGATAAAT
GCTCGAACCGCCAGCCAGTTCTTCTCTATATTGAAGACATAAGGCATATATATACTGCCGCCCGCTTGTTGAACCGTGTCTTGCTTGATGCAAGCTGTGT
TGTCACCTGATTACTATGCTGCTGCAGTACCAGCATATCAGTATGGTTTGTCTAAGATGTTGCCGACTAAATAAAAATCTGTATCGTTTGGCTAAAAAAA
AAA
page-top