Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23538  (registered. 2012)
Contig Information
Length 694 bp
Clones alternative view 46 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 9
Wh_KMP Shoot grown under continuous light 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 8
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XF Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 12
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig23538
CGCCAGTGGGCACGCCATCCCCGCGACAGATAAGGCGCGCCTTGCCTTGCAGCCCAGCCGGCCGTATCTTCATAACCAAATAGCCCCGCACCAAAACGCA
CCCCACTAGCATCATCATCACACATTCCCAGCGCAGATCGTCTCAACAACTCAGCAGCTCCGTCCCGATGGCGTCGCTCACCATGATGGCGTCCCTCTCC
GCGGCCGTGGCGGTCGACCGGCGCGCGGCAGCCCCGCGCCGCGGCCTCGTGGTGGCCCGGGCCGCCAAGGTCGAGGGCCAGCAGGAGCCGGCGGCCAAGA
TGGCAGCCGTGGAGCCCGCCACCGACGGCCGCCGTGCCGTGGTGTTTGCTGCCGCCGCTGCGGCCTTGTCGGCCATTGGCGGGGTGGCGTTCGCCGAGTC
GGACGTCAAGAAGGGGAGTCCCGAGGCCAAGAAGAAGTACGCCCCCGTCTGCATCACCATGCCCACCGCCAAGATCTGCCACAACTGATCGTGGGGAGGG
GGCGATGATGATGCGGGTGGGCGGTAAATATTGTACTACGTACGGTTTTATCTCTTGTTGAAGTTCGAGCTTAGATGCATAAGGCCGCGTTGCGCGCGCT
TGGACGCCGCCATGGACGGTCTCTAATGTTGTTGTATTATCCATTGCAAATTCGAGGTGAAACCGCACTTGTTTGATTAAAAAAAAAAAAAAAA
page-top