Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23508  (registered. 2012)
Contig Information
Length 1185 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 1
Wh_VHS Shoot with heat shock treatment 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_CA 3
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125559227|gb|EAZ04763.1|| hypothetical protein OsI_26926 [Oryza sativa Indica Group]
Score 259
Evalue 6.00E-71
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23508
CTTCAACAGAAGAACCAACAGTGTATAAAGAATGTAAATATGAGTGAACATGTGATAAGTTCAATTTTCTGTAATACAACCGGATAGCTCATGGGCACAA
GGTCTGATCCGTCCTTACCGTAAATTACACAATGGTACAGGTATACTACATGGGATACACCAACAATGGGTGGTAAATAAAAACTTCTAGCAGGAACACC
ACAAACCAGATCTAACTTATTGCTGGCAACAAATCAAATTGTCTACTGATAAGTCTGATCTATATTAAGGGTTTGTAATCACAGATATGTAGTCACACTT
GAGCAAAACCTTGTATGAAATCATTCCATTTATCACCTTTGTGGTCCTTTATACTGTTCTATGTAGCCTTGGCATATGGGGCAAAAATGGCTTTGACATC
TTCAAACACCTCAGGAATTGGTTTTGCAGCATCGATCTTCTTAACCTTGTCCTTCGCGTCATAGTACTCAATCACAGGCAAACTGGATTCAACAAAAACT
TTGAATCTCTTCCTGATAGTCTCGATGTTGTCATCAACTCTACCCTCATTGCGTCCCAAAAGACGCCTTTCCATCTCTTCCTCGGAACAATTGAAGAATA
GCACAAATGCAGGCGAAATTTTTGTAACATTCTCGAACGCAGCACGATTCTCTTCATTCCTTGGAAACCCGTCGATGAGGAACTTATCATTCTCATTCTT
TATCATGGCTTGCTGCAAGAGCTTTATAGTCACCTCCGACGGAACAATCTTTCCCTCCTTTATCATGTTCTCAATCATAGCCTCGTGCCGAATTCGGCAC
GAGGGTCAAAACATGCTGGCTGGGGTGTCATGACCAGCCACAGGAGTGGTGAGACCGAGGACACATTCATTGCTGATTTGGCTGTTGGTCTGTCCACGGG
TCAGATCAAGACCGGGGCTCCCTGCCGGTCAGAGCGTCTTGCCAAGTACAACCAGCTTCTGAGGATCGAGGAGGAGCTGGGCGACGCTGCAGTGTATGCT
GGCCTCAAGTTCCGCGCACCGGTGGAGCCCTACTAGACGGTATCTTCGCGAGTTTTTGTGAAAATGGGTGTGTTTAACCTCCGGAATGAACTCTGGTTGA
AGCTCTTAGGATTGAGCAATAATGCCGCGCATGTTTATGTGAACGGAACGGATATGTACCCCCAAACTTGCTCCAATTTTGGTCC
page-top