Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23497  (registered. 2012)
Contig Information
Length 909 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XA Root 3
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125542092|gb|EAY88231.1|| hypothetical protein OsI_09683 [Oryza sativa Indica Group]
Score 327
Evalue 1.00E-87
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23497
ACCGACGCTGATCGGACCTGGATGGGGCAAACATTTCCGAGAACGACGCCTATCCATCAAACACTGGAACTGTGCATATCAAACACATTTGAAAGGTAAA
CGATAATTGTCGTCAAACTCGGTTCCGCCGTCGGTGGTTCGGACAGAACCCACGGCCGAGACAAAACCAACCGGAGGGGCGCTAGAAATGAAAGACGGGC
CAGAGTTCTCACAGGACCATGTCTCCGGCATATACAGTAATAAGATGCCAATCAACCCTCAACCAACAAGGAACCCTTCACAACAATGAATGGCGTGACA
AGATTACGACGACGACTCTTTCTTCTCCTCCGGCTCCGCTTCCTTCTTCGCCTCGGGTTCCTTCTTCTCCTCTGCCGCCTCCTCAAAGGTCTCTCCTGGG
ACGAGCTCTGGAACGTCGTCGTCGTCGTCCTGGGCAGCACCGATGCTGGCGCCGCCAGCCTCACCGCCAGGCATCTGCTTCTGAAACTGCTCGGCAAGCC
TCCGCAGGTTGTCCAAGTTATCAGGGCCCAGTTGGTTGATAATTGTCGGCAGTAAATCTTGCAGCTTTTTCGTCTGTGGTGTTCCACTGACAACCCATGT
GTTTGCAGCAATAGATGCTTGCACTTTCGGGTTCTGAAATTGGATGACTACATCATCCTTGAAAATGTTGACCTCTTCAATACCAGGAATGGTGTTGACT
CCTACTCTTTTCAAGGTGCTTTGGAGCCTCTTGTCATCGGTGGTCGTGGTCTTGTGAACGGCCTTCTTCTTCCTGCGCACGCTGCCCTTGCCCCCGGTGC
GCACGGCACCGGCCATCTTCTTCAGCTTGTCGACATTCATCTTGGGCAGGCGACGCCGGCGGCGGCGGCGGCGGCGAGGGGAATGGGGGGGTTAGTGGGG
GAGAAGATA
page-top