Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2348  (registered. 2012)
Contig Information
Length 977 bp
Clones alternative view 74 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 4
Wh_yd Spikelet at late flowering 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 16
Wh_PCDAM Anther at meiosis 12
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XA Root 2
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 10
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|118154067|gb|ABK63978.1|| ZIM motif-containing protein [Triticum aestivum]
Score 287
Evalue 1.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2348
TTTTTTTTTTGAAACGGAGACGGCACAGATGATATCATTTATCGACTACGATAACAATGTATCAGTCAGACAGGCACGACAGCCACGATTTACATCATCG
ACACATTCATCATAGCAGTACGGTTCCGCAGACCAAAACAAGTTCAGATACAGAGTAAACTACACAATGACAACAGAACAATGACAATAGAGGTTCTGGT
CGGATCATTATTATCGTCACGAACGATGATGGTTCTACGGTGTAACATCACATCAGCTAACACACGCCCCTTTCCTTCCAAACATCAGGGGCAGGGCCGT
CTTTCTTCTTTCATGGTTACTGGGCCTTGCCCTCCGCGACCACTTCCATCCCAGAAGATGCTCCCATGCCTTCGGATGGCTTCCCGGCGCCGTAAGGAGC
TTTGCTCACCACCCTGTCACGGCGCTTCTCCAGGAAGCGCTGAAGGGAGTGTCTCCTGGCGATGGGAAGATCAGCCTGAAGCTTGCAAATCGAGCCAGGA
TCCGCGACAGCCTGAGGTTGTCCATTTGCTACAGAAGTGCTCTGGAGTGAGAGCGACCGCGTAAGCATGGCTTGGATAGCATTGGTCGCAGACATCGCTG
GAGGCTTAACAGCAGTGGTGCCATTGCTTTTTGAGGCCGCAGCTGCTGCTGCTGCAATGAGCATGATTGCTTGAGCCTTCTCTGGTGGCACTGAGTCATA
CACACATACTGACCCACCATAAAAAATGGTAAGCTGTCCCGGATTTGCTGGAGGGCTCGACATTCGCAACATTCCAGACCTGCCGTTGGCGAGCGGGGGT
CGGCCGGTGAGCCCTGGCTGCTGGGTCTCCTGCTCCTTGTGCTCCTGCTCCTTCCTCTCGGCTTCCTTGCGCTGGGCCTCCCCCTGCTCCGCCTTAATAG
TGGCTGCGCTCCTCTCCAGCAGATCCATCTCCGTCTCGGGTCTCAACTAACTGCTCCTCTCTCTCTCCCTCTCTCTC
page-top