Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23469  (registered. 2012)
Contig Information
Length 1034 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_h Spike at heading date 1
Wh_EM Dormant seed with water absorption 3
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 4
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242037399|ref|XP_002466094.1|| hypothetical protein SORBIDRAFT_01g001100 [Sorghum bicolor]
Score 291
Evalue 7.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23469
TTTTTTTTTTAAAGCAGATAAGAGGAATCCATTGGCATCATGACAATCAGATCTTATACAGTAGGAACATCTTTGATATCAAGCTAAGGAGAATCTGAAA
GCAATCTGAGCACGCCTAATGTCAAGGAGACCACACACTAGAGCAAAACTCACCAAAGGCTGGAGCTCAGGTATATTGTGAACCAATCAACTAAAAAGCG
GTATGCAATCATCATCAAAAAGCAGCTAAAAAGGAATCCACTGGCAACTCAGCATTCATAACTCGGATAAAAACTCGGGAGAAACTAAAAGTTTCCAACT
GCAGCAAATACAGAAGGCCTAGGAGAGGGAGCAAAACAGGGCCGTCATAGAAAACCATGACCACATAGCAATTCAGGTCAAGTAACGCTTCGCTATTGGT
GGGGCGGAGTCTATGAGATCAGGCTTTTGTCTCCTGGGCTACCTCCTCAAAGGTCTCACCGGGAACGAGCTCCGGAACGTCGTCGTCGTTCTCCTCCTTG
GGCTGGATGGCGCCTGCAGCAGCCACCTGCTTCTGCATCTCCTCAGCAATCCTCTTCAGGTGCTCCATGTTGTCAGGGCCCAATTGGTTGATGATCGAAG
GAAGAACATCTTGTAGCTTCTTGGTCTGGGGAGTCCCACTGACCACCCATGTGTTTGCGGCGATGGACGCTTGCACTTTGGGGTTGAGGAACTGGATGAC
GAGGTCGTCCTTGAAGATGTTGACCTCCTCGATGGCGGGGATGGTGTTGACGCCCACCCTCTTGAGCGTGCTCTGCAGCCGCTTGTCGTCCGTGGTCGCC
GTCTTGTGCACCGCCTTCTTCTTCCGGCGCACGGTGCCCTTGCCGCCGGTGCGGACGGCGCCGGCCATCTTCATGAGCCTCTCCTTGTTCATCTTGCCGG
AGGGGGTAGGTCGCGGCGTCGGCGCCGGCGGGCGGTGGGGCTTCCCTTCCTCCCCTTGGAGATGCGCTTGTTCTTGCCGACCGCCATGGTTGCCGCTGCG
GNNNGAGTGGCGGCGCTGCGGCGTCTGGGGGCTG
page-top