Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23446  (registered. 2012)
Contig Information
Length 1100 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125550795|gb|EAY96504.1|| hypothetical protein OsI_18406 [Oryza sativa Indica Group]
Score 556
Evalue 1.00E-156
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23446
GTATAGCGACGACGCGGATGCAAAATCTCTCTCTTCTCACTCAGCAGCCCGCGGTGCGGGCGCAGACCCTGCGCTGGATGAGGGTCCGGCACGACGGGCA
CTCCTTCATCCCCTGCTTGACGTGGAGGTCGTTGCACTTGGCGCAGACCACCTGGTGGGCGCAGGGGAGGAACACCACCGACATCTCCTCGCTCAGGCAC
ATGACGCACTCGCGGTCTCGCTGGATGTCGTCGAAGTCGAGGTCCAGGGCCGCCGCCCCCGCCATCTTGGCCAGGATCTGCGCGTTGCCGCCGTTCTTTC
TCCCCTCGGAGAGACGCAGGGCGCAGGTCTTGTCATCCGTTCCCCACTTGGGAGCAGCTGCCTCTGAAGCGTCCAGGGATACCTTCAGCTGCGAGATCTG
CTGCTCCAGGGCACGGATCTCGCTCTTGTATCTCTGCATGTCGTTCTCAGCTTTGAGGTGCAGGAAGTTCTCTTCCGACCTCAGAGATGTCTCAATCTGA
CCCCGCTCTTTCCTCTCTGAGCTCACACAGGCAATTGCCTCAGTCTTCCTAGCCTCTTCCTGTCTCCATCTTACCTTGAGTTGTTCCTTCTTCTCTTTAG
CATGCTGAAGTTGTTGCTGAACCCGAGATAGTTTGCTCTTTTCAGATGCAAGCTGCTCTTGCAACATGGCTCTCTCGGATTCCCAATGCTGGGACCTTTT
AAGACTGCTCTCATCCTTCTTTGAAAGCTCCACAAAATTTGCTGCAGACTCAGCTGCGTGCCGCTTTGCGGCTTCCATCTGCATCCTAAGTTGTGCATTC
TCAGCCTCACGCCTACGAGCAGAAGCATCTGCTTTATCCAGTTGATTGTTTGCCCTAGAAATAGCAGACTCCATCTCTAAAAGCTTCTTCCGAGTGCTCT
CTTCCAGACAGTGCCTTTCATCATGAAGTCGGCTCGCCTCTTCCTTCTCTTTCCGGAGTGACTGAAGCTCCTCCTTCTCTTTGGCAAGTCGCCGTGTGAC
CTGCATCACCTTCTCCATAGCCCAGTCTGTCCAATCCCTCATATGTGCTTGCAACTCTTTCTGCCTCTGGACAAGAATCAAGACCATTTCATCCTTCTTA
page-top