Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23377  (registered. 2012)
Contig Information
Length 983 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_EM Dormant seed with water absorption 2
Wh_VABA Shoot with ABA treatment 2
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115486063|ref|NP_001068175.1|| Os11g0588300 [Oryza sativa (japonica cultivar-group)]
Score 375
Evalue 6.00E-102
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23377
TTTTTTTTTTGAAACATCAAATTTTGTTGAGTAAATGCTGGATGGAACATGACATCACTGGAAACAATACTAGTATTGCTTACTTCATGTCGAAATGTCG
TAATGAAACAATACTAGTATTTCTTTCTTTCATCGTACAGTACATGGATGCTAGTACTTGTTTTAATCCCAAGACAAGAAGAAAGAAGAATTGGGTAAAT
GTGTGTAGGATCCATCTCTTCAGAGCTTGGATGCTGCTGGGTTCAAGCGCGCCTTGAGTTTGAAGATGAGCTCATGGACCTCATCAAAATGAGGGCTGGT
GGCCTTCTTCACATTCTCCATCCAAGCGCGCACCTTGTCGTGAGGTCCCAGAATTCTGTCACGTCGCTCATCACCAACAACCTCCAGCTGCATTATCTCG
CACACGAGGCTGAGGTCTGCGATTGATGGCTGGGGGTTGCCATTCAAGAATTTTGCATCGCCTTTGAGCCACACGGTTTCGATCGTTCCCAGTGATCGCG
ACAGCAACTTCTCGGCCTCTTTTGCGGTTTCAGGATTCGGTGTGAGGCCGAGAGCAGGACCCAACGCGGTGTGCAGTACATAGGTTGCTGCACCACGGCG
CAGATTAGAGTGATGCCAATCCAAGACAGACTCGAGTTTTGCTCTGGTAAATAAGTCGGCCGGATACCAGTGATCTGGAACCCCGGGGAAGACGGTGGCA
AGATACCTCAGAATGGCATGGCTTTCAAATAGTTTGAATCTTCCATCGACGATTGTTGGGACCTGTGCCATGGGGTTGATTTTGGTAAACTCTGGTGCGC
GGTGTTGTCCCTTGGCGAGATCCACGGTGAGCTCCTGGAAGTCGATCCGGTTGACCTTGCACAAGATGATGATGGCGCGCGACGGCTGCGACAGCCGGTC
CGCATACACCTTGAGCACCGCCGCCATCCTCAGCTTAGGATTCGATTGGATTCGATTGATCCACACCCTCCTCACCTTTTTTT
page-top