Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23217  (registered. 2012)
Contig Information
Length 883 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115448707|ref|NP_001048133.1|| Os02g0750600 [Oryza sativa (japonica cultivar-group)]
Score 223
Evalue 2.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23217
TTTTTTTTTTAGCCAAAGGAAAAATGAAAAGATGGTTGTTTCCACAATACAATTTACACAACAGCAAGCATCCAATCCATTCCTTGACTCCTGCTACAGC
AGCAACATCCCAAGGAGGAACCTTTACTCCCAGCCAGTCCCACCAGATCCCCAGCATGCTTTCAGGAGTGTCGAGTACATGCATGCGTCTCTAGATCGAG
TTTCAATGGCTCCAGGAACTGGATGTCAAAATGAATACACACCGCGCCGTTGACGCAACAAAAGCACAAGAGAAATTCTACAACTAGGCGCATCGAACAT
CACCGGGGAGGTGCCGTATCACAGTATGGTGCATCCACATCTGTTCTGCTTGGGGGAATTGCCCAGCTGCTTCTGGTTTTTGTCAACTTGTGGAGGGCGC
ACTACCACATGCATTGTAATTACACCTCCAGGGACCTCTCCTATTGTAACACGCGACTCGGCAAGTGTCCGGTTATTCTCCAATATCTTTCCACCATTGA
TGAGCTTCAGGTCATTGACAGTTTTCGGAGTTATTTCCTTATCTTGCGGCCACCGGGCGAGGATGAAGTCCTTGAGCGCGGAGACGGTGGTGGCGGGGTC
GTACTTGCTGGGCCCGATGTCCGTGCCGTCGAAGAGCCGGAACTTGACCTCGATCGGCTCCTTCCCGCCGGCCATCTCCGGGCCGGCTCACCGCCCACCG
CCCACCGCCCGTCACCCACCTTCCTCCCAAGATCCGAGAGGCCCCGGATCAGAAGTCCATGGCGCAGAAGGGGCCGCACGGAATCCACGCAAATCGGCCC
GGGGTCGGATTCTAGCGAGGAATTCTTGCTTTCGTCCGGGGGNNNNAAGCGAGGGGACGGCGACTCGGCGAGGAGGGGGAGGG
page-top