Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23200  (registered. 2012)
Contig Information
Length 1065 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226508302|ref|NP_001149620.1|| LOC100283246 [Zea mays]
Score 615
Evalue 4.00E-174
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23200
TCACCACGCTCGACAACGGCCTGCGCGTCGCCACCGAGTCCTCGCTCTCCTCGCGCACGGCCACCGTCGGCGTCTGGATCGACGCCGGGAGCAGGTACGA
GACGGAGGAGGCCGCCGGGGTCGCCCATTTCGTGGAGCACATGCTGTTCAAGGGCACGGGGACGCGCAGCGCCGGGCAGCTCGAGCAGGAGATCGAGGAC
ATGGGCGGCCACCTCAACGCCTACACCTCGCGGGAGCAGACCACCTACTACGCCAAGGTGCTCGACAAGGACGTGCCACGTGCGATGAATGTTCTCGCCG
ACATTTTGCAGGACTCTAAGCTCGAGGACAACCGCATTGAACGCGAGCGCGGTGTCATTCTCCGAGAGATGGAAGAGGTTCAGGGACAGTCGGAGGAAGT
TATATTCGATCATCTCCATGCAACTGCATTCCAGTATACTTCTCTTGGCAGGCCAATCTTGGGTTCTGCTGATAATGTCAAGTCTATCACCAAAAAGAAT
CTCATAGACTACATTCAAAAGCATTACACGGCTTCTAGAATGGTCATTACTGCTGCTGGTGCTGTTAAGCATGAGGATATTGTACAGCAGGCAAAAGAGC
TGTTCAAATCGCTGCCAACCGACCCTACAACAACTAACATGTTGGTTGCTGAACAGCCAGCCATTTTTACTGGTTCTGAGGTACGAATCATTGATGATGA
CATGCCCCTGGCCCAATTTGCTGTTGCCTTCAATGGAGCATCCTGGACAGATCCTGATTCTATTGCATTAATGGTTATGCAAACTATGCTTGGTTCGTGG
AACAAGAGTGCTGGAGGAGGGAAGCACATGGGTTCGGAGCTTGTACAGAGAGTAGCAATCAATGAAATAGCTGAGAGTATAATGGCATTCAATACAAACT
ACAAGGACACTGGCCTGTTTGGTGTCTATGCTGTCGCTANNNNTGATTGCTTGGATGATTTGGCTTTTGCAATTATGCAAGAGATGAGCAAATTATCATA
CAGGGTTACCGAAGNNNATGTTATTCGTGCACGCAATCAGCTGAAATCCTCCATCCAACTCCACC
page-top