Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23182  (registered. 2012)
Contig Information
Length 797 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|258644428|dbj|BAI39688.1|| putative CLB1 protein [Oryza sativa Indica Group]
Score 416
Evalue 2.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23182
TAGTCTCTATACACGGTTACAACTTACAAGACCCAAGCGGATCCGTGTATTGAAAGGCTAATATACAGGCATCGTAGAGGAAGAAGGCAGTCTTATCGTG
TGAAGCTATGCAGGTTTCACTGGTCCCTGTCACGATCACGGTAGATTGGCTGTGCCGTCCACCTGAAGTGCAGGTTCAGCTTTCCAGATTTAGCACCTTG
CAGCACATATGTATCTTGGAACTCGCCTTCGAGTATCGCCCTGGTAAGTGTCAAGATGCATCTCCCTATGTAATCCTTTCCAAATGTATCATGGTCCCAT
ACTTCCACAATGAGCAAATCATGCAGGGCATCTTCTACTACAAAATCAAATGTCTGATTCCATATCGGATTTAACGTCTCAGTCACAACCCTAGTCTTCT
TTTTGGTTTCCCCCTTCTTCAGGTACAGGACGACAAACGGGTCAGCCTTCCCCATCACATCCATTGCTGGTATGTCCTCTGCAGATATAACAGTTACTGA
AAGGACTCCTCTCGTAATAACATTTTTCCTCTGGTTGACATCATATCCATTAGATTCCGTCTTGAGGACCTTTTCCAAAGAAGTTAACTGGATCTGACCA
GCAAAAGGATTGGAAACCCCTTCTTGTTTCTCAAAAGGGTAGTACAGGAGCTCTAGGTGGACCTGACCACNNNNNTTCTTATCACGCTGAATTTCCAGGT
CTTTCACAAGTTCCAACCAAACATCCTTGACCTTTCCANNCGTAACATCCGATAAGTCTACTCGAGCGCAGCCAATAATCTCTGACGGCTGGAGCCC
page-top