Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2317  (registered. 2012)
Contig Information
Length 1121 bp
Clones alternative view 35 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_CA 1
WH_SP 4
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115447473|ref|NP_001047516.1|| Os02g0634900 [Oryza sativa (japonica cultivar-group)]
Score 456
Evalue 2.00E-126
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2317
TTTTCCTCTTCTCTTCGCGTTCGACACTGCTTCCGTCCCGTCCCCCCTCCGTCTCTCTTCTCTAGCAGCCGCCTCGCTCTCTCGCTCCATCCGATCTCCT
CCCGCAGCCCGAGAAAGCCGACGAGGTAGTCCCGCGCTTCCGCCATGGGCGACAGCCAGTACTCCTTCTCCCTCACCACCTTCAGCCCGTCGGGGAAGCT
GGTGCAGATCGAGCACGCGCTCACGGCCGTCGGATCGGGCCAAACCTCGCTTGGCATCAAAGCTGCCAATGGCGTAGTTATCGCCACCGAGAAGAAATTG
CCTTCTATTTTAGTGGACGAAACATCTGTGCAGAAGATTCAGTCACTGACTCCAAATATTGGAGTTGTCTACAGTGGGATGGGTCCAGATTTCCGCGTTC
TTGTCAGAAAAAGTCGGAAGCAGGCACAGCAGTATTATCGGTTGTACAAGGAAACCATCCCGGTGACCCAGCTTGTCCGAGAGACTGCTGCTGTTATGCA
GGAGTTCACACAATCTGGTGGTGTAAGACCATTTGGTGTATCACTGTTGATTGCTGGGTATGATGACAATGGTCCGCAGTTGTATCAGGTTGACCCATCA
GGATCTTACTTCTCCTGGAAAGCATCAGCGATGGGGAAAAATGTGTCAAATGCAAAGACATTTCTTGAGAAAAGATACACCGAAGATATGGAGCTTGATG
ATGCCATTCATACTGCAATTTTGACTCTGAAAGAAGGATATGAAGGTCAAATCTCTGCCAACAACATTGAAATTGGAGTTATCCGGGCTGACCGTGAATT
CAAAGCTTTAACTCCAGCAGAGATCAAGGATTTCTTGGAAGAGGTGGAGTAAGTTGCCCGTTGACAGTTTACTGTCTCGAACAAGAAAAGTTTCCGGTCC
ATGAAGCTTGTCTCATGTTTTTAATTGGTCACTTAAACATATTGTAAACTGATTCGCTCCAGTGACACCGGAAGAACTTACATTTGAAGCTTTGTGGATG
GCATTGTGGACATGGAAGATAACCTAATGTTAGGTGTATGTTTTGTTTGGCCAATCTCTGGATTTGCTTGGTCATTTTAATCTGGTCCCTCATGATTATC
AGCTTGGAAACAAAAAAAAAA
page-top