Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23158  (registered. 2012)
Contig Information
Length 814 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499354|ref|NP_001147027.1|| polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 206
Evalue 1.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23158
AGCAAACAACAGGCACAAGTTCAGGGCTCACTTATTCTTTCAAGTTCATCCAAATCTGCTGCACAACAGCAGCAAGTTCAGACACAACCAGACATAACGC
TAGACCACAGCACGGTAGCAACAAAGAACAGACCAGACGAGGACACGCTGACAATCCCATCGAAGGACACAGAAAGACAACTGACTTGTGAGCCCAGAGA
CATAAGCAGCTCCATGGCCAGGCACTTACTGGCCACCACGGAGGCGGAGCACCAAGTGAAGGGTGGACTCCTTCTGGATGTTGTAGTCCGCCAGAGTGCG
GCCATCCTCGAGCTGCTTACCAGCAAAGATCAGACGCTGCTGGTCCGGTGGGATGCCCTCCTTGTCCTGGATCTTCGCCTTCACATTGTCGATGGTGTCC
GATGACTCGACCTCAAGCGTGATGGTCTTGCCGGTGAGGGTCTTCACGAAGATCTGCATACCACCCCTGAGGCGAAGCACCAGGTGGAGGGTGGACTCCT
TCTGGATGTTGTAGTCAGCAAGGGTGCGGCCATCCTCAAGCTGGTGAGGGTCTTGACGAAGATCTGCATTCCACCACGCAGGCGGAGCACCAGGTGGAGG
GTGGACTCCTTCTGGATGTTGTAGTCAGCGAGGGTGCGACCGTCCTCAAGCTGCTTGCCAGCAAAGATGAGGCGCTGCTGGTCCGGAGGGATGCCCTCCT
TGTCCTGGATCTTCGCCTTGACGTTGTCGATCGTGTCAGAGGACTCGACCTCAAGGGTGATGGTCTTGCCGGTGAGGGTCTTCACAAAGATCTGCATCTC
GGAGGACGAGAAAG
page-top