Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23037  (registered. 2012)
Contig Information
Length 796 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115458618|ref|NP_001052909.1|| Os04g0446300 [Oryza sativa (japonica cultivar-group)]
Score 348
Evalue 5.00E-94
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23037
TTTTTTTTTTGGCTAGTCAAAACGCTGGGACACACGGTGATATAACCATTATAGATTTTTTTTTATACCAAGAAAAAAGACTGCAATGATGTATTATCTT
AATGGTGCTTCATTCACCAGTTCAAACAGTACTGCTATCAAAAACATTGTCTATTTCGATTAGGCTAAGCTTCATCCTGATAATGATGACAAGGGCTAGT
AATTCATTTGCTCTTGCGCTCGTTGTTGTAGTCATCAATCAGTCTCTCAACATCCTTCCAGAACAGGCCCTCCACAAGAACACCTTCCTTTGTAAACCAT
TTTGTAACACTCTTAGTGAAGTGGACAGGCTTGTGAGCAGAGATAGATTCTGGATCCGCGCTGGCTATTGAAAGATTGTACATGTCCAAGAATCTTGGCA
ACTTTGAAGATATAACAAGGCCAGTGTTATTGAAAGAACCAGCAGGAGGGTGGGTGAAGATGATGGCATCCTTTTCCTTGGTGTAGCTAAGGATCAGTAG
CACCACATTCATCACCACATACAGCGCGATGCAACCGAGCAGGAACTCGCGGTTCTGCGGGAACTTCTTCGGGTAGAACTGCGCGAGGAGCGCGATGGCG
ATCACGGCCGTCCCGATCAGGAGCTTCCAGTTGCCCAGCCGCGTGTTCTCCACATAGCCCTTGCCCTTCACGACCTCGGCGACGGTCTCGTCGAGGAGGT
GTTTGATGGAGTGGGGGTCAAGGAGGTTGGCCTTCTTCGGGGTCACCTTCGCGGGCGTGGTCACCGCGCCGTCGCTCGCCATCTGCGCCGTCGTTG
page-top