Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23026  (registered. 2012)
Contig Information
Length 901 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
WH_XR Roots, 18 day old plants were grown hydroponically 9
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XC Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14164983|gb|AAK55326.1|AF355458_1|AF355458_1 thaumatin-like protein TLP8 [Hordeum vulgare]
Score 468
Evalue 4.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23026
TTTTTTTTTTTTAGTAAATAGCCCTCTCAAATCTTTTTAGCAATTTCCTTGTCGAATACATCCATTTCCCGCTTACATGTGATTGTACATATGAACGTAT
GCATCCAATCACGCTTATTTTTATATAAGATCAGATAGACTCCTTCTTGTCTGTGTGCTCGATCGAGACCGCTTCAATGGCTGCCTAGTTTTAGCTCGAT
CATGGGCAGAAGATGACCTGGTAGTTGGTGCCGCCGGGGCAGGTGTAGGTGCTGGTGGCGTCGTCCTTGGGGTAGCTGTAGGCGTCGGAGCACTGGCCCT
TGAAGAACCTCGAGTAGTCGGTCGGCCCGCAGTTGTTGGCCGCCGACCCGGTGCAGCAGTACCGGTCCTCCTTGAACACCGTGCACGCGTTGTTGCACCC
TCCGGCGGCCCGCAGCTCGTTGGGGCACTGCGGCGTGATCACCCTGGGGCACTGAGGCCCGCCCTTGGGGCACCCGGGGGAGCCGGGGGCCGGCAGGAAC
GACATGGGCACGTTGTACCCGTCGATGAGGGAGATGTCGAAGAAGTCGAGGTTCATGTACTTGTTGAGCCCGAACTCGGCCAGCGTGTTGGGCGCCTGCC
CGTACTGCGTGCACTGCAGCTTGCCGCCGCAGTCGCCCGTCTGGCACCGCCCGTTGCCGGCGCCGTCGAAGCTGCACCCCGTGCGCGCCCACACCCGCCC
GCCCGTCGTGCCGGCCGGCACGTTGATGCTCCACGTCTGCCCCGCGTCCAGCTGCCTGCCCCCGCCGGCCGGCACCGCCGCCGCCCACACCGTGTACTGG
CACTTGTTGATGACGGTGAAGGTCGCCGCGTCGGTCGCAGCAGCGACGAGGATGAGGATGAGGACAGGGAGGAGGACGGAAGAAGAGGGGAGGGACGCCA
T
page-top