Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22982  (registered. 2012)
Contig Information
Length 655 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222637747|gb|EEE67879.1|| hypothetical protein OsJ_25703 [Oryza sativa Japonica Group]
Score 236
Evalue 1.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22982
AGCACTCCTATAATAATAAAAGCCCATCATTTCGCGAGCTCTCGGGCAAAAGAGATACATATGTCGAGAGTTCTCTCTCACATTCACAGGAAAATAAAGA
ATATCTGGAGAACTACTGTCCCTGTGGAAAGAACAGAGAAGCCCCCAGGAAGATTTACTGAATCGTGGAGTTCAAAACTGCCAGGTGAAAAAATTGCTTC
TATTCCAGAGCCAAATACCGACTATCAAGGGATGATTTGTGTTTGCTCAGGTGCCCGACACTCATGCTTCGGTGACATCGGTAGGATAGCTCCCAAGAAC
TCTTAGGAAGGTGGCGAACTCTTGCTTTAAGTTACTCAGAGCATTTTGTGCATTCGGATCAGCCATTGATGCCTCGAAATCCACATAGAAAAGGTAGTCG
AAGTGCTTCAGCGGCGTGGAGTTATCATCAGCTACACGTAGAGGCCTTTTCTTGTGTGGACGGCTTTCCATCTTGGTGAGGTTAATTTTCCTCAGAGCAA
ATACTGCAAGCGCCTTGAAGAGTTGTCCAGGTCCTTCTTCCAAAGAGAACACTATGCTAGTCTTGAATGGCTTATCAGTGCGANNAATGATGGGTTCCCG
AGCCAGCATCATGAAACGGGTTACATTATCTGCGTCATCCTGGATATTTTCTGCA
page-top