Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22947  (registered. 2012)
Contig Information
Length 1163 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|51535521|dbj|BAD37440.1|| unknown protein [Oryza sativa Japonica Group]
Score 483
Evalue 1.00E-134
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22947
CGCCGTCGCCGATGTGGTTCGCCGGCCGGGCGAGCGCCACCGCGCCGCTCCCCCTCCTCCTGCTGCTCCTGGTCGCCGGCGCTGCCGCCACCGACCAGAT
CTTCACCACCTCAGGTGTGCCTTTCGGGAAGAACTCGCGCGAGCCGAGGTACCGCGTGGAGTTCCATCCAGTCGATTCGCCCTACCACCCGGAGAATGGC
CAGGAGTCTGAACCAATGACGGACCACGAGGGGAGACAATACACCTGCTACCTACCAGTGGAAGAAACCAAGACCATGAAGTCGATTGTCCCACAGAATG
CAACCAATGTTATAATAGAAAGCGAACGGAAAGTTAAGCCAAAGGAGCCAGATGAACTGCTGGAGGTTCTCAAAGACCAGTGCTTCTACAGGCATGAAGG
TTGGTGGTCTTATGAGTTCTGCTATTATGGAAAAATACGACAGGTTCATGTAGAAAATGAGAAGGTTGTCCAAGAGTATGTTCTAGGTGAATATGACCCT
GATGCAACCGATGCTTACCATGACAATCACACCTCCGAGTCTGCTGATGAGGATCACGTGAAAGATACTTCTAAGAGGTATCATGCCCATGTGTACACAA
ATGGAACTGTATGTGATCTCACAGATATACCGCGGTACACAGAGGTTAGGTTTGTTTGTTCTGAGCCCACTGTACTGATCAGTTCGATAAAGGAGATATC
TTCCTGCAAGTATGTTTTAACTGTCCAAAGCCCAGTGCTCTGCAAGAACCCGTTGTTTCAGCAGGAAAAACGCACCTTCTTCATCCACTGCAATGAGTCG
CTTCCCGAAGCAGAAGCTGAGCCCGCCGAGGACGACGACTCTCTCCCAAAAGAAGCTCAGATGTCCATCGTTCCAAACCCCGACGAATTGCATAACTACG
CAGCTTACGCTACCTGATTGCCCGCCAATCACGGTGCCCCCAGCTGATGAAAGATACCGTTATTTTGGAGGTTCAACAGCAAGTTGGCAACATAGTATAA
CTATCCCCTGGCTTGGTTCTGTCTGACGCCAACTAGTGGTTACAGGGTGCTCTTTGAGCAGATATCCATTACCGAAACAGGTTGAGATTGCCTTAGAGGA
AGATTAAGGGCAAACCAAGAGTGTCCTGCTGTACTGTAGTGGTATATAATTTAGTAAAGGGGG
page-top