Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2293  (registered. 2012)
Contig Information
Length 731 bp
Clones alternative view 100 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 2
Wh_r Root 4
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 3
Wh_VWD Shoot grown with dessication 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 5
WH_XA Root 10
WH_XB Root 7
WH_XC Root, treated at 50 microM Al for 6h 16
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1710521|sp|P50888.1|RL24_HORVU|RL24_HORVU RecName: Full=60S ribosomal protein L24
Score 324
Evalue 5.00E-87
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2293
GACAATTTTTAACATAAGTACCATTCATTATAAATAAACTCATCGAGACAATCCAAAACGTTAACACCATTCAGCCTCACAGATAAGGTGCAAATTCAAG
ATGGCGGGGTAATAACTTGACAAAGGTCTATGATAGTAGGATAGGAAACAAGGCTAGGCAGCACAATTCTATGTCTATGGCGTAATCGACTTTCAACGCT
TCCCGCCGCCACCGCCAATCTTTGGGCCCTTGGAACCCTTCTGCACGGCGCCCTTGCCCCCCTGTGACTTCTGGGACTTGGTCACCTCTGCCTTCTTGGC
CTTCTTCTCATCCTTGGTCTTCTTGATGCGCTCCTTGATCTCACGGAGAGCAGCTTCTCGGGCAGCATCACGGACTTCAGGCTTCTCAGCCCTCTTCTTC
TGGATAACTTCCAGAGTGGCACCAACAATCGACCGTGAGTACGGCTTCTTGGTGGTGCGGCGCCTCTTCTTGGCAGCCTCAGCATGGATGTCCTTCTTGT
GCTGCTTCCTGTACATTGCTGTCCAGCAAAGCTTTGCAGGCTTCAGGCGGTTGTGGAAGTAGCGCTTGCATTTTGAGTTGGCAAAGAGGAAAACCTGCGA
ATCCGAACGAATGAACCTGATACCCTTCCCAGGGTAAATCTTCTGGCCGCTAAAACGGCAGAGCTCGGTCTTCAGAACCATCTTCTCAGCCTTAGAGAAC
TTTCACAAGCTCCTACCTTGGGCGAGGAGGA
page-top