Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2292  (registered. 2012)
Contig Information
Length 899 bp
Clones alternative view 64 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 4
Wh_r Root 1
Wh_DPA20 Seed DPA20 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 5
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XF Seedling, infected with leaf rust 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226507100|ref|NP_001147230.1|| NADH-ubiquinone oxidoreductase 13 kDa-B subunit [Zea mays]
Score 333
Evalue 2.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2292
TGCAGGTAATCACTAGGCAATGACACTTCAAGAAGTGCAGGGTTCTAGAAGTACATTAATCGAAAAGTTATAAAACAAACCAGCATTTGATCTTGTCAAC
ATCGATTAATAGAAAACAGAAACAGTATTTTACTGTGTTGAAGCACTGCGTTAAAAACGCATTCACATTCACAGAAACAAATTTATTCTGCTCGGGACAA
CAAGCAAACTGCAGGCAAAGGACCCATGAGACTAGTCTCAACTACACACTGCAACAGGTGAAAAATGATGCATCTTGAAGAGCAAGTTTCATGACTTCAC
TTGCGGAGGAGAGTCGCCCTGCAGAGCTGGATCTGATTTGATGGCATCTAATGTCTTGAAGAACTCCTCAGGTAGTGCAACGGGCCGGTGCTGCGGAACA
TGCTTGGGAATAGGTGCGTCATCTTCAATCACCTCGCATTCGTAGTCATCAGGAACACCCCAGGGATCCCACTCGATCATCTTGCCGATGAGCTTGAGCT
CGTCCTCGGCCTCCTCGATGAGCTCCTCGACCTGGCCGCAGCCGAGGCGGTCCTCGATGCGCTTCCAGTCCTCCTCCTCCTGGCAGATCTGGAGGCGGTG
GCGGGTGAAGGACTCGACGGCCTTGCGGTAGCCCTCGTCCTTGGGGACGGCCTCGATCTCCTTGAGGGTGCGCGTGTAGAGCCCGATGAGCACATTCCGC
GCCTCGGGCACCACGTCCAGACCCACGATCCCCGTCGTCTCCTTCACCGCCCGCGCAGAGCGCAGGGCCGCCAGCCCGCCCCCACCGCTCAGGATCCGCC
GCAGAAACATCCCGCCGCCGTCTCCTTCTTCGGACTCTCTCTCTCTCTCTCTTTCTCTCTGGTGAGATGAGGTGAGGTGCGGGTGCGACCGTTCGTGTG
page-top