Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2272  (registered. 2012)
Contig Information
Length 1087 bp
Clones alternative view 118 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 7
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 4
Wh_r Root 3
Wh_yd Spikelet at late flowering 6
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 7
Wh_SHC Shoot grown with cold treatment 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 6
Wh_VSCB Liquid cultured tissue 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XA Root 7
WH_XB Root 11
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57471706|gb|AAW50984.1|| ribosomal protein L13a [Triticum aestivum]
Score 412
Evalue 4.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2272
TCTTTATCTTTATATGTGTGCAGTATCCCGCNNNACAGTAGCTTTACTAGAATTTTCATGCCGCTAATCTGATGAGTGAAAAAGAAAGACATGTACAAAG
GCAAACACATTACTTCTAACTTTCCAACGATAGGTCAAAGAGACTGCCATGGCTGTAGTAAAGAGAAACAGCCTCAGCAACATATAATCACCTGATAGAC
ATGCACTAGAATCTCCAAATGCACACATTTGATAAACGAAACAGTTCACCAAGTAGAAAATTTCAAATGAGGGTAGCAGAACTGCATGCATAACAAAGGT
TTACCAACCAGGTTGTACTATCACAGAGTTACCAAACTACTCAAAGACAAGAGGACAGAGGTTTCCCAAAACTGATGGCGCACGGAAGCTCTAATCTCTC
TTAGTATTTGATCGGGGCTAGGATCTCCAGCTGAGTTCCCAACTTCTCCTCGGCCGCCTTCTCGGCCTTGACGCGGAGCTTCGCCAGTTGCTTTCTCCTG
TCGTAGGAGACCTTGGCCTTCTCCTTTCTCTTTTCCTCCAGCTCCCTGATGGTGTCGGCGTAGTTCCATCCGACCTCCTTGGAGAGCTGGCCGAGGAGGC
AGTACCTGTGCCCAGGCTGCAGCCTCAGAACCTTGAGCGCGTCGGGGATGACCATGCGCTTGGTCCTGTCGTACGGCGGCGGGACGCCCTCGTACGCCTT
GAGCCTGGCGAGCGCGGCCTCGCCCCTCGCGGTCTTGTGCGGAATCATACCGCGGATGGTGCGCCAGAGGATCTTGGCCGGGGCGCGGAAGTGGATGGGG
CCGTGGGAGGGCTTGGTGTTCATCCGCTTGCGGAGGAAGCGGAGGTACTTCATCTTCTGGCGGACGAGGCCGCCGGACATGCAGATCTCCTCGCAGCGGA
CCACCACCACGCGCTGCCCGTTGAGCAGCTCCTTGGCGACGATCGAGGCCAGGCGGCCGAGCATGTGGTGGCGGGCGTCCACCACCACGCGCTTGGCGCA
CACGCCGGAGCCGGACACCATCTCGCCTCTTACCTGGCGGCGGCGGCGCTACTGCTAGGGTTTGGAGTTCGCCTCGTGCCGAATTCC
page-top