Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22716  (registered. 2012)
Contig Information
Length 1070 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
WH_XR Roots, 18 day old plants were grown hydroponically 10
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 10
WH_XT Roots, 18 day old plants were grown hydroponically 18
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig22716
ATGGACAGAGGGAGTACTTGTTTGGACAAAGCAGTGTCACCAGAAAGATACGTAGGGATGGAACAAATGCACGGAACACATACAGTGACATATAGATACA
CATACACATGCAGCTCTCTTCTAGGAGAGGCATCGCCAAGCATGCAGCTACCGCGCGCTATTGGCCTTTTATTCTCACGCCTTTGTCGTCGTAGCTACAG
CTAGCTAGACGTATACGCGGGCGTGTACGTACGCACGAGCCATAGTCGGTCGAGGTAGGTCTCCGTATAGAGCTACTACTCGCCGGTGACACGTACGCAC
TATAACTTACATATAGGAGTACACTCTTAATAGTTATGGAGTACAGTATTATAGATGCGACACCGCGGACGTCACACCACCTCCTCGATGATGGCTCCGG
CCACCGCTTCCCAGCCGCGGAGGTGCTCGTCCACGCTGCTGCTGCCACTCACATGGAGGTTGAGGCCGAAGCTCATGCACTGTTGCACGCATAATTCCTT
TCTTGTTGGGTCTTGCCAGTGTTGACATTTCAACTCGCAGTCTTCTCTGCTAGGATGATGATGCTGCTGGCTGTGGCACTGGTCCACACAGAACTGTCTC
CTGGCCAGATCTTGGTAATAGGCGCACTTGTCGTCGCAATCGTCGTTGCCATGGTCATCGGCACGCGAGCCGACCTCCTCCTCCAAGGCATGAGGGCGCT
CATGGACGCTGCTGCTGCCACCCACATGGAGGTTGAGGCCGAAGCTCATGCACTGTTGCACGCATAGTTCCTTTCTTGTTGGGTCTTGCCAGTGTTGACA
TTTCAACTCGCAGTCTTCTCTGCTAGGATGATGATGCTGCTGGCTGTGGCACTGGTCCACACAGAACTGTCTCCTGGCCAGATCTTGGTAATAGGCGCAC
TTGATGTCGCAATCGTCGTTGCCATGGTCATCGGCACGCGAGCCGACCTCCTCCTCCACGTGCAAGGTGGTAATGGTTGTGGCCCCATCCTCCTGCTCGG
CGCCTACCGTCGCCGGAGCCAGCAACACCATTGCGAGCAGGAGGAACCACCAAACCCCACCCTTGTGAAT
page-top