Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22708  (registered. 2012)
Contig Information
Length 703 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_SP 1
WH_XA Root 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218202406|gb|EEC84833.1|| hypothetical protein OsI_31924 [Oryza sativa Indica Group]
Score 259
Evalue 2.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22708
TTTTTTTTTTGAGGCACAAGCGAAAACCAACACACAGGTCTCTACTCAAATTTCAAGTGCATACTTCAAGACGTTTGCGTAATTCAACACGTGCGACCGA
CAAAACCAGATAGTACATTTCACCATTGCTCACACCAAAAAGGCGGTCCATACATGAAATCTTGCAAAATGGCAGTATTTTTCTTCTCAAACAGGGATGT
AATGTCTACTACAAAGGTAGCAACCAAGACTAGTTGACTAGATAATGCTTTACTCGTCCTCCTGGCTGCGGAGCCTGGCAAGCTTGTTGGTGACCACGAC
GTCGAGCTGCGCAGCACGCTCAACGATCGCCTTGCGCTTCTGTGTGGACACGTTGTGTGCGATCTCAGCACAGTAGGTCCTGTTGTGCATCATAAGCAGC
TCCAGCTCAGAGACATTGTGGACAACAAACTTCTTGAACTTGTTGGGCAGGTAGTGCCTGGTCTTCTTGTCTGAACCATACCCGATGTTGGGCATCAAGG
TGCATCCCTTGAACTTCCGCCTGACGCGGGAGTCGATACCCTTTGGCCTACGCCAGCTTTGCTTGAGGCCGATGTAGCGGTCGCTGTGCGCCCTCTTGAA
GTGCTTCACCCTCTTCTTCACGATCGCCTTCTTCAGCAGAGGCACCGCCATCTTGGGAGAACTGCGGCGGAGCGGGCGGGCGGGCGGGCGGCGGCGGCGG
CGG
page-top