Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2269  (registered. 2012)
Contig Information
Length 811 bp
Clones alternative view 100 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 3
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 5
Wh_VSCB Liquid cultured tissue 8
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_SP 6
WH_XA Root 6
WH_XB Root 14
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218192814|gb|EEC75241.1|| hypothetical protein OsI_11539 [Oryza sativa Indica Group]
Score 161
Evalue 9.00E-38
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2269
GCACGAGGCCAGTAATCAACATCATCGGCTCTATGAGCAACGAGATGTTATTGAATTTGTAGTACACCTGGAAATGCAAATTATGCTCTGGAATAACATC
AGGCTTTTCCAAGACAAGAACTGGCCTTCCAGCAATGTCAAGGTGTGAATACTTCACCTCTTGCCATTGATTTGTTGGAAATGGAGCTGAAACATCAATA
TCCTTTGAAGCACGAGGGCTTCTCTTCGTCCTCCCGCAGCGCCTCCTCGAATCCAAGAGATCAAGTCGCTGTTGCTGTGCCACTCCCCCACCAGCCGCCA
CCATGCAGAACGAGGTGGGTGACATGGTGGACCTCTACATCCCCAGGAAGTGCTCGGCCACCAACAGGATCATCACGGCCAAGGACCACGCCTCTGTCCA
GATCAACATTGGTCACGTTGATGAGAATGGCCTCTATGATGGCCGCTTCACCACCTTTGCTCTCTCTGGGTTTGTCCGTGCTCAGGGTGATGCTGATGGC
TCCCTGGACAGGCTGTGGCAGAAGAGGAAGGCTGAGATCAAGCAGCTCTAGATGTTGCTACTAGTTTTACCTGGAACTTGTTTCCTTCCCATGTCTACCT
AGCTCTTGGATGTCTGTGGTTAGTTTCAGTTGCTACTATGGAAGCTAAGACTTGATGTCACTAGGCCTGGTTTCTTGTGAACATGTTTTGAGTTTAATCT
GTGTTGAATGCTTGATATGTGTACCTTATCTCGTTGCTTAATGTCATACTGATGATTTGGCCCTTAAAAAAAAAACAAATTATGGCCATAAAAAAAAAAA
AAACCTTAAAA
page-top