Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2266  (registered. 2012)
Contig Information
Length 861 bp
Clones alternative view 139 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 6
Wh_SH - 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 8
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 16
Wh_VABA Shoot with ABA treatment 14
Wh_VHS Shoot with heat shock treatment 10
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 10
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 7
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 12
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_SP 3
WH_XE Seedling, infected with leaf rust 5
WH_XF Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|22204118|gb|AAM92707.1|| putative glycine decarboxylase subunit [Triticum aestivum]
Score 306
Evalue 2.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2266
AATTTCCTTTTCCCTATCCTCCCACAGCCTCTTTCCACTACTACCACCGAGCCACCATCCCCTACAAGGAGAGGGCAAAGAACACACATTCACTTTGTTG
CTTCAGGTTGCAACAGCTAAATTAGGCTACAATGGCTCTGAGGCTGTGGGCAAGCTCAGCTGCCAATGCCCTCAAGATTTCAAGCAGCGGCGCCAGGGCC
GCTGCCCCGGCCTACTCGATCTCCAGATACTTCTCCACCGTTATTGATGGCTTGAAGTACACTTCCTCCCACGAGTGGGTCAAGAACGACGGCTCCGTGG
CCACGATTGGCATCAGTGACCACGCCCAGGGCCATCTCGGGGAGGTGGTGTTCGTGGAGCTGCCGGAGACCGGCACGAAGGTGAGCCAGGGTGGGGCCTT
CGGCAACGTGGAGAGTGTGAAGGCCACCAGCGACGTCAACTCGCCCATCTCCGGCGAGGTCGTCGAGGTCAATTCGAAGCTGTCCGAGACCCCGGGCCTG
ATCAACTCGAGCCCGTACGAGGAGGGGTGGATGATCAAGGTGAAGCCGAGCAGCCCGGCGGAGCTGGAGGGCCTGCTGGACTCGGCCAAGTACACCAAGC
ACTGCGAGGAGGAGGACGCCCACTAGTGCTCCCTTGTTCGCTTATCAATCCTTTTGCTGCAACCATATCGAATACTCTTGTCTACAATAATTAAACCAGC
TTCACCATGCGTTCAGTTCATCGGTTCCAATTTTCTTGTGTCGGTGTACATGGCGGCCAGCACTTTGTTATACCATTTCAGTGACCGTGACATCAGAGAT
ATGGGAAAGAGTTTGTAAGTTATAGTGTGTTGGTAAAAAGAGACATTATCATCCACCAACA
page-top