Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22645  (registered. 2012)
Contig Information
Length 1307 bp
Clones alternative view 108 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 20
Wh_CSEC Callus 7
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 10
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 5
WH_XA Root 5
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242035869|ref|XP_002465329.1|| hypothetical protein SORBIDRAFT_01g036580 [Sorghum bicolor]
Score 676
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22645
GCAACCCCCGAGAGATCACACCATGTTCGGCTTCGGTCACCACGGCCACCATGGCCAGAACCCCCCGGCCCACGCTCCGGCCGCCGCCGGCGGCAACCAG
CCCACCTTCAAGATCTTCTGCAAGGCTGACGAGGGCTACTGCCTCTCCGTCCGCGACGGCAACGTCGTCCTCGCCCCCTCCAACCCCCGCGACGAGCACC
AGCACTGGTTCAAGGACATGCGCTTCAGCAGCCAGATCAAGGACGAGGAGGGCAACCCCGCCTTTGCCATCGTCAACAAGGCCACTGGCCTCGCCGTCAA
GCACTCGCTCGGCCAGTCCCACCCGGTGAAGCTCGTGCCATTCAACCCGGAGTACCTCGACGAGTCCGTGATGTGGACGGAGAGCAGCGACGTCGGCAAG
GGCTTCCGCTGCATTCGCATGGTGAACAACATCCGCCTCAACTTCGACGCCCTCAACGGCGACAAGGACCACGGCGGCGTGCACGACGGCACCACCGTCG
TCCTCTGGGAGTGGGCCAAGGGCGACAACCAGAGCTGGAAGATCCTCCCCTGGGGCGAAGAGGCCTACGCCGGAGGCAGCGCCAACGCCCCCCGCGGCGG
CTCCTCAGAGCCCACCGTGCGCATCTTCTGCAAGGCAGACGACGGCTTCAGCGCCACCGTCCGCAACGGCGCTGTGGTCCTCGCGCCCACCAACCCCCGC
GACGAGTACCAGCACTGGTTCAAGGACATGAGGCACAGCAACCGCATCAAGGACGAGGAAGGCTACCCGGCCTTCGCCCTCGTCAACAAGGTGACAGGCG
AGGCCATCAAGCACTCCCAAGGCGAGGGCCACCCTGTGAAGCTGGTGCCATACAACGCCAACTACCAGGACGAGTCAGTGTTGTGGACTGAGAGCCGCGA
CGTGGGCGCCGGCTTCCGGTGCATCCGCATGGTGAATAACATCTACCTCAACTTTGACGCTCTCCACGGCGACAAGGAGCACGGCGGCGTGCGCGACGGC
ACCTCCCTCGTGCTGTGGAAGTGGTGCGAGGGCGACAACCAGCGCTGGAAGATCCTTCCCTGGTAAACGTGTCATGCTGCTGAAGCTGAGTTGATCGCCA
CCGTGACCCGGAGTTGGTAGAGATCGGCCTGTGATCTGTTGCCGTGTCGTTAGAATAAAAGTCGTGTGCGGTTGGTGATGTGTCCGTGAGTGTGTGTTTA
GTTTCTGTCCTGTCGTTGTGTCCTGCTATGGCGAGCTATCCGATGTAATAAGCATTTGGCACTTGTGCTTGTTTTTCAAACCATGGATCGTGATGAGAAC
CTCTGTA
page-top