Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22621  (registered. 2012)
Contig Information
Length 795 bp
Clones alternative view 27 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_SH - 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XE Seedling, infected with leaf rust 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|52548244|gb|AAU82109.1|| ubiquitin-conjugating enzyme [Triticum aestivum]
Score 313
Evalue 2.00E-83
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22621
TCAAAGCATCCAAATGGAAAGCCACACATATCATGACACGACAGAGATTTTACTTAATGGATAACGAAACGTCAGGTAGAACAGACTACCCAGACCCAAC
GGACTTGACATGGCAAGAGTACATTCATACGAGTTCAACAGGGGCACGACGGCCTCAAAAGTCCATTCACTTCGTCACGGGGTGGGGTGATACTTTGGCT
GGTTATTTAGGTGATAACGGTTCTTGGGCCCGGCGCATCCATGGTCACCAGCTGGCCGTCCAGGCTCTAGCCCATGGCGTACTTCTGCGTCCAGGAGCGC
GCCGTGGACTCGTACTTGGCCCGATCAGTCTTGTACATGTGAGCGATCTCGGGCACCAGAGGATCATCGGGGTTCGGGTCCGTCAGCAACGAACAGATTG
ACAGCAGGACCTTTGATATGGTCAAAGCCGGGCTCCACTGTTCCTTGAGAATGTCAAGGCAAATGCTGCCGTTGCTGTTGATGTTTGGGTGGAACACCTT
GGTGCGGAAAGAGACCTTCGGGGGCTTGAAGGGGTAATCCGGTGGGAAATGAATGTTCACCAAAAATAGGCCACCGGTGAACGGGCTGTCCGAGGGTCCC
ATGATAGTGGCCTGCCAGTGGAACATGTCCTCACCTACAGGACCTGCGCTGCACGAGGTGGGAGGGTCCTTCTGCAGGTCCTTGAGCTCCTTGAGGATCC
TCTTGGACGCCATGGGATCAAACCCGGCCGGCGGGGGCGCGGGGGCGGCGGCGGCGGCCTCTCCCCTCTGCGGCGGCGGCGGGCGGCGGTTGGGG
page-top