Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22572  (registered. 2012)
Contig Information
Length 720 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219111569|ref|XP_002177536.1|| nucleoside diphosphate kinase 3 [Phaeodactylum tricornutum CCAP
Score 216
Evalue 2.00E-54
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22572
TTTTTTTTTTTTAGGATAGATATCAAATTTTAATTTGGTAACAAAGATATCAACTTATTTCTTTTCGAGAACCCACCCTTCTTGAGCTGGTGTCCAGTTG
TTAATTTCTGATTCCTTAAACCAGTGTGGAATTTCATGAAGAGCTCCTTCCGGAGAATCAGATCCATGACAGATGTTTCTTCCAATAGTAACGCACAAAT
CTCCACGAATTGTTCCAGGGAGAGAGTCGGCTGGGTTGGTTTCTCCCAAAAGTCTTCTTCCACCTTTAATAACTCCAGGTCCTTCCCAAACCATAGCACA
GATTGGTCCTGATGCAAAGAATGCAGTCAAGCTTTTGAAGAATGGCTTAGCCTTGAGGTCATCATAATGCTCAGCAGCAAAAGCAGGAGTGACAGTGACG
AGTTTCAAAGCAACCAATTTGTATCCTTTCTTCTCAAATCGTTGAATAATTTCTCCAACCAATTGTCTTTGGACACCATCTGGTTTGACAGCGATGAAAG
TTCTTTCTTGTGCAGTTCCTGGGATTCCTGCAATTGGAACTTTAGCCTCAGCTTCAACAGAGGTTAATTGAGATGCAACATAGGTTGCTGATGCCCCAGC
AATGGCAGCTGCAAGCCAGTAGTTACGTTGGGTGTTGCGAGCAGCTTGAAAAATGGTTCGGCGAGCGACAACACTACGAGCAGCTCTAACGTTTCTGAGG
AGGGCTCTTGCAAACATGGC
page-top