Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22559  (registered. 2012)
Contig Information
Length 1117 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_DPA20 Seed DPA20 2
Wh_OKCS Seed DPA5 3
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XE Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242090471|ref|XP_002441068.1|| hypothetical protein SORBIDRAFT_09g019780 [Sorghum bicolor]
Score 420
Evalue 2.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22559
TTTTTTTTTTAAACATGAATGACTGATAAATTATCACTTTTAAGTTAAACATCGATGTAATGTTGAGGGGATTAAATACAGGCCTTCCAAATTATTCCCT
AGCAAACCATGTTCCCTTCTTCAGGTCCCCCAATTGCTAAGTCAAAGTTTGTGCTTGAGTTCATCATGCTTTCTTGGTCTTGGGCTTAGGGGCCGGTGGC
GGGAACACGGCCCTGAAGGTCCACGCAGCGAGAATGGCACCGATGAAGGGGCATATCCAGTACACGTACAGCTGCTCCCAGGTGTTGTGCAGATTGTTAA
CATACGCCCAACCAAAGGCGTTGGCAGGGTTCATGGAGGGGCCGGTGTACGCGGCGCCGGTGAGGACGAGGCTGACGGTGGAGACTGAGAGCATCGCTGT
CTTGACGATGGGGTTGCGGGGTCCCTTGACGATGATGCAGAGGACGGCAAAGGTGATGACGAAGGTGAGCACCCCTTCAGCGACGGCGCCGGTGTGGGGA
TCCACCTTGAGCGAGGGTCCGCCGAGCATGTGCTTGTACTGCTCCGGCATCAGCTCGGAGATGGCCAGAGCTCCGCCCACGGCTCCGGCGGCCTGCGCTG
GTAGGCGGAGCGCGATGGAGAATAGCGAGGGGCTGGTGAGGCCCGCGGCGTAGAAGGCGGCGACGCCGGTGGGGTTGAAGCTGGCGCCGCCGAGGGCGTC
GCAGAGGAGGTTGAAGGCGAAGAGGAGGAGGGCGAGGATGGAGACGGTGACGAGGAGGGCGTAGTGGATCCCCTCGTGCAGGCTGAGGTAGGTGGTGACG
GCGGCCGTGGAGGCGCCGAGCGTGGAGACGCAGAGCACCCAGAGGAAGGTCACGACGCCGTCCGCCGCCGCCTCCCGCACAGCCGTTCCCATCGCCATCC
GAGCGTTCCTTCCGTGCTTGCTTCCCTCACTCCGTCGTCGCTGCTGGCAGTGATTGGTGGGTTGGGTTGGGTGTATGTATGGGTCTGGCTTGGCACACAG
CACAAGAGAAAGATGAAAAAGAAGGGAAGAAGATTGGAGGGAGGGAGCACGCCCTCCGTCCCTCTCGCCTAACAACCCAACGCCAACAGAACACCGACGA
TACTGCTATGATATCCT
page-top