Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22478  (registered. 2012)
Contig Information
Length 930 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_SHC Shoot grown with cold treatment 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 8
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 10
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|228480399|gb|ACQ41882.1|| germin-like protein 2 [Triticum aestivum]
Score 442
Evalue 3.00E-122
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22478
AACACGGCAATAAAAAGTAGTACATTCAATTCCTCATATTGTTTCTGAAGGCTAACTTATTCAATCTTATTACAACTGCATGCGAGATTAACCTGAAACT
TGAATACATATCTTCTGCTGAGAATTATTAAATTTTGATAGCATGCATATATTGAACCATATGTTGATCATTTCAGGGAAGGCTTCCAGGAATTAAAACC
CAGCGGCAAACTTGGACTTGAGAAGTTCCACGACCCCGGCTTCCACCCGGAGTGCCTTGGTGAGCACCGGTGTTGGGATGGGTGGGTTGGAGCCGAAGAG
TGTGAGTGGCACGAAGACGATGCCGGGGTTCTGGCTGTTGAAGGAGACGACCATGGACGCCTCCGTCTTACCGACGTTGAACTGGAAGTGCATGAGGCCC
CGCGGGATGAGGAAGGTCTCTCCGGCGCGCACCACCCTCGAGTAGAGCTTGTTTCCAGAGTCAAGGCTGCCGAGGATTCCCACGAGGAGCTCACCTTTCA
TCACGATGCCAATCTCGGTGGCGCGTGGGTGGATGTGCGGCGGGTTGGTGCCCCCTGGTGCGAAGTCCACACGGTTCATGGACACACCCAGCGTGTTCGT
ACCGGGCCACTCGGCCACGTCGAGCTCCGTCACGGCCGAGCCATTTGGGGTGGACGTGTTGCCGGCCTTGGCCAGCTTGGATGAGAAGAGGAAGTCGTCG
CCGGCCTCCGACATGGGCTTGCACGTGTGCCCATTCAACGACACCGCCTTGCCGTCGAGGTCGGCGACGCAGAAGTCCTGGAGAGGATCAGGGTCGGTGG
CTAGGACGGTCAGAGCTAGGAACAGCATGGCGAACAAGCCAGCTACTAGGGTTTTAGAGCACCCCATTGCTTGCTATGCAACTGATGGGCTAGAGTTTGT
TGATCGAGAGTGCGTAAGGCACTGCCTCGT
page-top