Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22473  (registered. 2012)
Contig Information
Length 1312 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125550589|gb|EAY96298.1|| hypothetical protein OsI_18197 [Oryza sativa Indica Group]
Score 173
Evalue 4.00E-41
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22473
TTAAGGAGATATTGAAAATTATACCATAATAAAAATAATTACATGCATATGTGTAGTTATTACTCTATCATACATACACATGGAGATTACATGTACAAAA
GCATAAATCCCAAGGCAGGCATGCACTGATCACATGGAGAGTACATATCAAGTCTCGTCTCAGCTAGGATATGCCTTGGACGCATGCACGTAAGCATCTT
CAGCTAGTTGGCAGCTAGTAATTGGCTAAGCAAAGATCGATTGTGTATGAAAAAGATCATGAGGCACCGGCGACGGCGAGCATCTTCTTGTACTCGACCT
CGTCGTCGCCTATCCCCCAGAGCGAATCCGAGCAGCAGTAGTCCCACACCGGCGATGAAGGCGGCGGCACTATCATCGACGGCACGGCGGCTCCCCATGC
GTAGGAGTCCATGATGGCGTCGTTCCAAAGGAGGTGGCTGTCCATGCCGATGCCGGCGGTGTAGAGCAGCTGGTTATCCGCTTGTTCCTGGCTGGCCGCC
GTCTCTTGGTCGCGGTGGCCGTGATGCGAGTTGTTGTCGTTGTCGATCGTTGAAGAGGAGGAGCTGGACGTGGTGGCCGGAGACGCCGCCGACATGGACG
TGGACGTGGTCGTAGAGGCCGAAGCAGCAGAGGCGCGCGTGTCCTTGTGGAGCTTGCGGGTGTGGGTGCGCCAGTAGTTCTTGATCTCGTTGTCGGTGCG
CCCCGGCATGGCCTTGGCGATGCGTGACCAGCGGTTGCCCCAGCGGGCGTGGAGGTCGACGACGAGGCGCTCCTCTTCGGGGCTCATCCGGCCGCGCTTG
AGGTCCGGGTGCAGGTAGTTGACCCACCGGAGCCGGCAGCTCTTCCCCGTCCGGTTAAGACCTGTCGCCAAGACAAACACAAGAGCAAGAGGTGCCGGCG
GAGACCGAGAGCGTTAGCACACAAAGGACCATGGCTACATCATATTTTGGTCCCAGACATGCATGCATGCATGGCGCATGCATGGCACGGCATGGGTCAC
CCGCCACCTTGCAAACCTGACACCTTAGCTAAGAAATCCCAGCGGCGCTCGCCGAAGAGCCGCACGAACCACGCCAGCTTCATGTCCTCCTGCTCCGTCC
ATGGCCCCTTGCGGAAACCACCCGGTGCAACTGCTTCCTCCTCCTTCCCCGGCGACGGCGCCGCCTTGGCCTTGGAAGCCTGCTTCGTCTTCATCGATGG
AGATGTGATGTGAACACAGCAGCTAGGCACCAAGGAGCTACGGACAGAAGACGTTGGTGGTGCGGCTGGTGGTGGGATCAATCAAGAGCCACTTGACTCG
AGGAAGAAACGT
page-top