Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22437  (registered. 2012)
Contig Information
Length 1895 bp
Clones alternative view 61 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 5
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 3
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242083824|ref|XP_002442337.1|| hypothetical protein SORBIDRAFT_08g018480 [Sorghum bicolor]
Score 805
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22437
TTTTTTTTTTAAGTTTGACCGAATTCGTAGAAAAAATATGGATATTTACAATCTCACGTACAATCAAACATTTTAAGTCATCTTCTTTCTTGCTAAGGTA
GAGCTGCATTTTTTTCACAAATGGTGGGTACAAAGTCACACACCCTGAAAGCCTGAAGCCACAGTCCAGAGAGACATCACAAGCCGCTCCACCAGGAAGT
TGCGGACACAACAGAACCAAAAATGCTGTAAATCTGGCGAAGCCGGGTTGACTTATCTTGATCTCATTGTGCCTCGGCCCAAAGGAATCAGAACCGCAAA
GCAAGATATATATTATTGCGTAGTTGCATTACAACTGTAGTTTCTTTCCCCCACAAAACCGATCTTTCTCCGTTTGCTTCACACGAATAGTTGTTCATAC
TAAATGTATATGGAAAAAAATGGACACAACTTAAACACCGGAACTATACAACGACGAATCATGCTTCAGCCATGACACAATCAATGGCTTGCTTGCAGAT
TCCAGTCATTGTGGCCTCTGGTCCATAGACCTCAATTGGAAGACCAAGCTCTGATCCTAGAGCACGCATTTTGGCGAGTCCAGTTTGGTAGTTTGGACCA
CCTCTGCGAACATAAATGTTCACCCTTGCAGCTTTTAATTTGGATTCCTTCTCTCTTAAAGCCCGAATGATGCCACTGAATGTAGCAGCGACATCAGTGA
AGTTTGCGATACCCCCTCCAATGAGAAGAGCTCTCTTCCGGCCATCAGGATCAGCAGTGGCACAATCCAAAACCACTCTAGCATAATGCAAAACTTCCTC
CTCTTTGGGAGCTCCACTGTACTCTGCATAATTCCCTAGCTCTGAAGCATATCCCAAATCTCCAACCGTGTCGGCATATATGACACTAGCACCACCACCT
GCAACCATTGTCCAAATGCGACCTTTCGGGTTAAGAACTGTGAATTTCAGTGATGCGCTTGTCTTCTCATCCAGTTCATGGATATAACTTTCTGATGGGC
TCAGGACTCTTCCGAAAGGTAGAGGGAATTCAATGTCACCCCACTTCTTAAAGTTCTTGAAAGCAGCTGTGTCATCCAGTTCACCTCTCATGTCGAGAGG
GTATGGTTCACCATTTACCAGGGTGAATGGGTTCATCTCCATAAATGAGAAATCCAAGTCTTGGAAAACAGAAAATGACCCTCTAATGAAATCGCCTATT
TTCGTGCGGACTTCCAAGGGAAGAGTGGCAATCAATGGAGCGCATGCATCAAGTGTCATTGGCTTCTCTGTTGGAAGAAAGATTGTCTTAACCTTGTCCC
AGTTCTCCTCAATCTCAATACCACCACACTCTGAGAAACTAATGGTGCAACCAAGCCTGTCTGACATAATTGAGAGATAATACTCTTGATCGTGTGGCAC
AAATGGCTCGACTATGAATGTTGTAATTGGAGCCTTACATCCACCCATCTCGACCTCAACTCCTAATCGCTCCTTGACAAATTGGCGGACTTGAGCAAGA
TCTAGGTTGAGGGCTACAAGGCCACTCTTCCCACGCTTGCCAAACAGCATGTCAGGTTTAACAACCAACTTCATCGACGAGAGCCATGGCTCCTGGTTTG
AAAGCTCCGTGAAATCCGTTGATTGTGTGACCTGCGCGGAGAGGATCTGGAGGTCGATGCCTGCGAGGCGCTTCAGGTGCTCCTTGAGGAGGCGCTTGGA
GTCGTACTCCCGGATCTTCTTCCGCGCCATGGCCTCGCCGACGCTTCTCGAGGCGGAGGACGGGTAGGTGGACGCTGTGGTACCGGTGGTTTGTAGCACT
GGCGCGCCGGAGCTTGGGGCGCGGGTCGCACCCAGGACGGGGTATATATAGGCAGCTCTGCTTTTCACTGGCTGCTCCAGTTTGGTGCTGGGTAG
page-top