Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22386  (registered. 2012)
Contig Information
Length 1507 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 1
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242073268|ref|XP_002446570.1|| hypothetical protein SORBIDRAFT_06g018280 [Sorghum bicolor]
Score 820
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22386
CCAGGCGACCCTCCTCGGCGGCGGCGGCGCGGGCGGCGATGCAGATGGCGGCGACCACAACGGAGTCACAGGTGGCCGTGCCGCCTCACCACCCCCACGC
GCACCCGCATCCGCACCCACCTCCGCATCACCCGCACCCGCACCACCACATGCCGCAGCCGCGGTGGGTCGTCCTCCCCTACCCGCCGCCGTCCATGGTG
GCCGCACCGCCCCCGCCCCCGCCGCAGTTCGCCAAGCACTACGCGCCGGGGCCGCCGCCTCCCCCTGCCGCGGCCGGGCGACGCACGCCGACCCCACCCG
CGGCCGGATCCGGCGGGAACGGCTGCGAGGAGAATAAGACGATCTGGGTCGGCGACCTCCAGTACTGGATGGACGAGAACTACCTCCACAACTGCTTCGG
CCCCAGCGGCGAGGTGGTAACAATAAAAGTTATCCGCAATAGGCAAACTGGACAATCAGAGGGATATGGTTTTGTAGAGTTCTTTTCCCATGCATCAGCA
GACAAAGCCCTTCAGAATTTTACTGGCCATGTGATGCCCAACACCGATCGAGCCTTTAAGTTGAACTGGGCATCCTATAGCATGGGTGAAAAGCGATCAG
AAGTTGTCTCTGACCACTCAATTTTTGTTGGTGATTTAGCTGCTGATGTTACTGATGAAATGTTGATGGAGCTTTTTGCTAGCAAGTATCGCTCCGTGAA
AGGAGCTAAAGTTATCATTGATGCAAACACAGGCCGTTCTAGGGGCTATGGGTTTGTTAGATTTGGAGATGATACCGACAAAGCTCATGCAATGACTGAA
ATGAACGGTGTTTATTGCTCTACTCGACCGATTCGCGTAGGACCTGCAACACCTAGAAGAACCTCTGGTGATTCTGGTTCCTCAACACCTGGTCATTCAG
ATGGTGATTCAAATAACAGAACGGTATATGTTGGTGGGCTCGACCCAAATGTTAGTGAAGACGAGCTGAGGAAATCATTTGCCAAATATGGTGATGTTGC
CTCTGTCAAAATTCCTCTAGGGAAGCAGTGTGGCTTTGTTCAGTATGTCAACAGAACTGACGCAGAAGAAGCACTGCAAGGATTGAATGGGGCTGTCATT
GGAAAGCAGGCAGTTCGCCTTTCATGGGGCCGCAGCCCATCACACAAACAGTCTAGGGGCGATTCCGGCAACAGGAGGAACAACAACAACATGTACTATG
GCACGCCGTTCTACGGCGGGTACGGCTACGCGTCCCCCGTCCCGCACCCCAACATGTACGCCCCTGCGTATGGAGCCTACCCCTTCTACGGCAACCAGCA
GCTGGTGAGCTAGAGAGAGAAAGAGCTTCGTCCCACTCCCTCCGATGGGGAACAAGGTTTTGATCCGGTAAGAGCATAGCAGCGTCAGAAGAGAGAGAGA
GTGAGAGAGAGAGAGAGATTATATAGATCGTCCTAAAAGTAAGAGGGTGAGACAGGTTATTAAAAAGTGAAAGAAACGAGTGGTGTCTGTACTCTGTAGC
GTCTGTT
page-top