Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22254  (registered. 2012)
Contig Information
Length 1707 bp
Clones alternative view 99 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_r Root 2
Wh_SH - 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 4
Wh_SHC Shoot grown with cold treatment 3
Wh_VABA Shoot with ABA treatment 6
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 17
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 21
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 12
WH_SP 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115383193|gb|ABI96817.1|| tonoplast intrinsic protein [Triticum aestivum]
Score 498
Evalue 9.00E-139
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22254
CAAAATCCAGAGTATGTACAGAAAAAAATGGACACAAGATTGGCAAGACATCAAGTTGCTAGGAGAGACAAATACATTTGTGCAAACATCAATCTTGACC
ATGGAATAGAAGCATTCATAATTGAGGACGTACATACATACACCAAGATAAGAGAAGGATGAGATTATTCCTGACTGACTGACTCGCACACACTGTTTAC
CCTGAATTTCTCAAGGACAAGATAGCGCAATGAAACTAAACTGGCTTACTGATGATGACGCGACGACGTACACTTGCTGGAATTTTTGAAGCGATTTCAA
TCTCTCATGGCGATGACGGATGGACGAGATGAGATTGAGGTTTTCAGTAGTCGGCGGTGGGGAGCTGCTCGTGGGGGCGCTGGCCGATGAAGCAGATGTC
GTAGACGAGGGCGGCGATGGCGGCGCCGGCGAAGGGGCCGAGCCAGTAGACCCAGTGGTTCTCCCAGACGCCGCTGACGACAGCGGGGCCGAAGGAGACG
GCGGGGTTCATGGAGGCGCCGTCGAAGGCGCCGCCGGCGAGGATGTTGGCGCCGACGATGAAGCCGATGGCGATGGGCGCGATCACCCCGAGGTCGCCGC
GCTTGGGGTCGACCGCGGTGGCGTACACCGTGTAGACGAGCCCGAAGGTCATGACGATCTCGAACACCACGGCGTTCCAGACGCCGACGCCGGCGGAGAG
CGAGAAGGCGCCCACGGCCTCGCCGCCGGTGGCGATCTTGAGGAGGAGGCAGGCCACGACGGAGCCGAGCAGCTGCGCCACCCAGTACACCACGGCCTTG
AGCAGGCTGATGTTGCCGCCCACGAAGGCGCCGAATGTGACGGCCGGGTTCACGTGCCCGCCGGAGATGTTGGCGCCCACGGAGACGGCCACGAAGAGCG
CGAACGCGTGCGCCAGCGCCGCCGCGATAAGCCCCGCCGGCGTCGTCGCGCCGCCGTCAGTCAGCTTGCCGAAGGCCATGCCGGAGCCTGAGCCGGCGAA
GACGAAGATGAGCATGGAGATGAACTCGGCGACGCCGGCGCGGAAGGTGTCCGGGTGGGACAGCTCCCCCGGGGCGCCGATGGCGATCCTGCTCACCGGC
ATTTTCGACGGGCACTCTTTCTTTTTTTTCTGGATGGATGGATCGGTTCGTGTGCTGTGTAGCTAGCAGTACCAACCACCACCGCTACTCCAACCCCACA
TTCGCTTGCCAGCAGCTCGAAGAGGATCGTCGGCGACCATGTCCGGGCGCGGCAAGGGAGGCAAGGGGCTCGGCAAGGGCGGCGCCAAGCGCCACCGGAA
GGTGCTGCGCGACAACATCCAGGGCATCACCAAGCCGGCGATCCGGAGGCTCGCTCGGAGGGGTGGCGTGAAGCGCATCTCGGGGCTCATCTACGAGGAA
ACCCGCGGCGTGCTGAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACCGTCACCGCCATGGACGTCG
TCTACGCGCTCAAGCGCCAGGGCCGCACCCTCTACGGCTTCGGCGGCTAGGCGCTTCCTCGCCCCTCCCCTGCAGATCCCAAAAGCTTGATGATACCGCG
ACTTGTGTGGTTTGCTACTTCCTCTGTAGTTCCAAGTGAATCGTGAAACAAAGCTACTCGCATCTGGAGTTGGAAATCAATATACACCGTGTTTCTGAAA
AAAAAAA
page-top