Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22239  (registered. 2012)
Contig Information
Length 817 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226491094|ref|NP_001150699.1|| ABC-type Co2+ transport system, permease component [Zea mays]"
Score 288
Evalue 6.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22239
CTCGCCATGGAGCTGCCGCTGTCTGCGCCGCGCGCGCATGCCGCCGCTGCCTTCCCCCGCAGCCCCACTTCTATCTCCCGCCTCCAATGGGTAGCCACTC
CCCACAGCCGCGCGCGCCCTCTGCACGCCCGCAGGAACAAGAACCCGAGGGGCGACGCCGCGGAGCCCAAAGTCATCACCATCGGTCGGCCCGGGAAGAA
GAGCAAGCGGCGCGGCGACAAGAAGCAGGATCAGCAGCAGCTCCCCGCGGACCAAGAAGATGAAGACGACGAGGAGGAGGATGACGAGGAGGACGAGAGG
GACGTGGCGATCCCGGAGGTGGTGACGAACCGGATGATGCGGCGTGTGGGGGCGTCGGTGGGGCTCCCGCTGGCGCTGGGGCTGGCCTTCTTCCCGGCCT
TCTACTACCTGAAGAAGGTGGCGAAGGTGGACGTGCCAAGCTTCATTCCCTACGGGCTGTCCTTCGTGTTCTTCGGGGCGGCGCTGGCCGGCGTGAGCTA
CGGCATCGTGTCCGCCAGCTGGGACCCCGCCAGGGAGGGATCCCTGCTCGGCTGGAACGAGGCCCGCCGCAACTGGCCCGTCTTCTGGGAGTCCTTCCGG
GGCACCCCTCCTCCTCCGAGCCCTCCTCGCCGGGGACGATGATGATAGGCTGTGGTGGTAACTCGGTTAAGCTTAATTACTTGTTTCCCTCAGTTTCTTC
TTCTCGCTGTACGCCTGTACGTAGCTGTAGTTGTTCTTGTGAGCGCGCGTGTGTGTAAAACAATGAGATTTTGTTGCCCAAAAAAAAAACAGTAAGAGAC
GGAGCCTCGTGCCGAAT
page-top