Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2218  (registered. 2012)
Contig Information
Length 734 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Wh_SH - 1
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242075544|ref|XP_002447708.1|| hypothetical protein SORBIDRAFT_06g013920 [Sorghum bicolor]
Score 182
Evalue 3.00E-44
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2218
GCACGAGGCCAAACCCTCGCAACCTCCCAGTCCCACCCACACAACCGAGAGAGATGAGCACCGGCGGCGCGGACAAGTCCGGCACCGGCGGCGGCGGAGC
TGGTGGGCCGGTGAAGACGCCGTCAGACTTCCTCAAGTCGATCAGGGGCCGCCCCGTCGTCGTTAAACTCAACTCAGGCGTCGACTACCGAGGTATTCTG
GCTTGTCTGGATGGCTATATGAACATCGCGATGGAGCAAACCGAAGAGTACGTGAACGGCCAACTGAAGAACAAATATGGCGACGCCTTCATAAGAGGCA
ACAACGTCCTATACATCAGCACGTCAAAGCGGCCCCTCACCGACGGAGCATAGGCCGAGTGGAGCATTCACATCATCATGATGTAATTTCAAGGTCGTTA
ACCCGATTATTGGTTGTGGTGATCTGACTGGTGCTGCCTTTTTCAATCTCGTACCTGTTGTCTGCTGTATTGCCTGCTGACAGAGACTTATCTGGAACAT
TTCGATTCGATGTTATCTGCGTTTTTAGCTTGGAGATGTTTGTGGCCAAGATTCTGCGATCAGGATATAGATAAGATTTGTGTTTTCATGGTCGTGTGCT
GCTTAGAACAGACATTACGTGTCTTAAGACACACCCAGTGTGCTACCACCGGTGCGATGTTTTTGTTGGCGCTTTGCTCTACAAACCTACACTATGTGTC
AGCCACGACGATATTATCTCTTGCAAAAAAAAAA
page-top