Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22154  (registered. 2012)
Contig Information
Length 778 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_r Root 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|40317418|gb|AAR84348.1|| glutamine synthetase isoform GSr2 [Triticum aestivum]
Score 352
Evalue 2.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig22154
TTTTTGAACAGAATCACAACCGGTTCCATGATTTCATTTATCGGAATGCGGAAAGAAGAACATTATTTTCAGAGTACACGGAAGACTCTTATCTGAACGA
GTAAAGTGAAAGACACGAAAGGCACGCCCCAAAAACAGACTAGACCTTGCAAAAGAAATGGAAACAGGAGACGTTTTGCAGAAAGAAATTCATCGTCGCC
CTCTCTCACTCCGAGGTAGAGGAAGAAAGCGTGTGCGTGTGTCATCTGCTGCTGGCTCAGAGGAGGAGGGTGGTCTCGGCGATCATGGAGGTGACGACGT
AGGGGTCCATGTTGGAGGCCGGCCTGCGGTCCTCGAAGTAGCCCTTGCCGTCCTTCTCCGTGTCGCGCCCCACGCGGATGGACGCGCCGCGGTCAGCCAC
GCCCCACTTGAAGGTGTTGATGTCGGCGGTCTCGTGGTGGCCCGTGAGGCGGCGCTCGTTGCCCTCGCCGTAGGCGGCGATGTGCTGCGCGTGCCGCTTG
CCCAGCTTCTCGATGGCCGTCTTGATCACCCCGTACCCGCCGGCCTCCCGCATCGACTTGGTGCTGTAGTTGGTGTGCGCGCCGGCGCCGTTCCAGTCGC
CCGGGATCGGCTTCGGGTCCAGGGACAGCACCACCCCGGCAACCTCCGTGATCCTCTCGAGGATGTAGCGCGCCACCCACAGCTGGTCGGACGCGGCGAT
CCCCACGGACGGCCCGACTTGGAACTCCCACTGGNCGGGCATGACCTCCCCGTTGATGCCGCTGATGTTGATCCCGGC
page-top