Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2211  (registered. 2012)
Contig Information
Length 1831 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242066184|ref|XP_002454381.1|| hypothetical protein SORBIDRAFT_04g029730 [Sorghum bicolor]
Score 758
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2211
TGCTGCTTCGATGGATGAACCATCATCTGAAAAAGGCTGGCTACAAGAAAACTGTTAACAATTTCTCTTCGGATGTGAAGGATGGTGAAGCCTATGCTTA
TCTTCTAAAGGCTCTTGCTCCAGAGACTTCCCCTGAAACCACACTGGAGACTAAGGATCCTGATGAAAGGGCAAAAATGGTACTTGAACAAGCAGAGAAG
TTGGACTGCAAAAGATACCTTACACCAAAGGATATAACTGAGGGTTCTGCCAACTTGAATCTTGCATTTGTTGCACAAATATTCCAGCATCGGAATGGTC
TAACTAGTGACATTAAACAAGTTACACTCACACAGACAGCATCACGTGATGATGTTCTAGTATCCAGAGAAGAAAGGGCCTTCCGAATGTGGATCAACAG
CCTTGGGGTCGAGTCATACGTGAATAATGTTTTTGAAGATGTTCGCAATGGATGGGTACTTCTTGAAGTACTTGACAAAGTTTCTCCTGGATCTGTCAAT
TGGAAGTTGGCATCAAAACCTCCAATTAAGTTGCCATTTAGGAAACTGGAGAACTGCAATCAAGTTGTAAAAATTGGGAAGGAGTTAAAGTTTTCATTAG
TAAATTTAGCTGGGAATGATATTGTTCAGGGAAATAAGAAATTGATAGTTGCACTTCTGTGGCAATTGATGAGATTTAATATCCTTCAATTGCTAAACAG
ACTGAGATCCCACTCCAAAGGATCCCAAGGAAAGCAAATTACTGATGCAGATATACTGAACTGGGCAAACAGCAAAGTGAAAGCATCAGGAAGAACATCT
CGAATGGAAAGCTTCAAGGATAAGAGTTTATCAAATGGAGTGTTCTTCCTCGAACTTCTTAGTGCAGTTCAGCCAAGGGTTGTGAACTGGAAAGTAGTTA
CAAAGGGAGAAGCTGACGAGGAAAAGAAGCTAAATGCTACCTACATCATTAGTGTTGCAAGAAAGCTCGGATGTTCTGTGTTTCTACTGCCAGAGGACAT
TATAGAGGTGAACCAGAAGATGATCCTAACTCTTACAGCTAGCATCATGTATTGGAGCCTGCTGAGACAACCACAGCCTGAAATATCTGAAGCATCAGAG
CCATCTAGCATGGCTTCGGACGCAACTTCTGACATTGGCTCGGAGGATGGTGCCTCAACAGCAGCACCGTCCGAGAGCGAAGAGGCAAACTCACTGTCCG
ATAGTCTATCCACCCTGACCACAGACGACGCCACCTCAAATGCTCCAGCTGCAGAAAACGGGAGCGACACCACCTCGAATGCTCCAGCTGCAGAAAACGG
GACCGGCGCCACCCCAGATGCTCCACCTGCAGAAAACGGGAACAACGCCACCCCAGATGCTCCACCTGCAGAAAACGGGAACGACGCCACATGATCCTGA
TGGTTATATTTTCATCCGTAGCACTGTCCATCAATTAGCTTTATATACAAGGGTTGGTACCAAAAGTTGCTGCTGCTACCAGAAGTGATTTTTTCTCTTT
TCAGGTAGCATAATAGGTACACACCATCATACAGATAGATCGTAGCCGCCGTTTGTTCATTAAGTTAAATTTTGCTGAATAGTAAGTACTATACGGGAGA
AAGAGAGAGAAATACAGACACATACATATAGTAGGCCGCCGGTTGGTTTGGTTGGCTGGCCATTTCCTGTACACTCTTTAGTGCACAGCTCCATTGCTCA
ACTCGTGCCTTGTCGGTCCGTCCATGTGCTCCGTATTTTTTTTCCTTCCAGTTTGCTGTACTGCTTGGACCATTATCGTTTTTGTACCAAACTGTCGTCG
CTGCTGTGGAGTGTGGACCATGCATGGTGAG
page-top