Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig22089  (registered. 2012)
Contig Information
Length 1444 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_r Root 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 3
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig22089
ATTGAGTTGACGCTTCCTCCGAATGGTTTTTCTAGAGAACGCTCTTTTTTTAGGGAAAGACACAATCCGAGCCCGAGAAGGGCTCGAGCATAGCCCGGCT
TTGAATTAACAAAGCTATCAACCGGCCAGGATTACAGCGGAAACAGACCCAGCAACAAGGAAAGAAAATAAGACAGGGATGCAACCCTACAGCGGCCGAT
ACAAGGAGCTAAAGGAAAGCACAAGCGCAACGATAAAAGAAAAGGCTACAACTTGAAGATCTAAGTTCTTGAGGGGAATCGCGCCACCGGAAGAGATCGT
TCTGCACCTGAAGCCAACAAGATTGAAAGCCACCACCAACAGACGAGGGCCAACTCTTCACGCACAGGCTTGAGTGATGCTGCGCCGTCGACAAGGAGAA
ACTGCTCCCCGAGAGCAAGCTCGCCATAGATGTCAGGCCGACCGAAGGCAAAGGGCGCGACCACTCCAGCAAGCACATCGAACACAAGCAGCAGCCCACA
ATTGAAGCATGTTGTTGATGCAAGGCAAGGACCATAGGCGTCCCAAGAAGACACGGCACTGATTTGAGCAACACAGCCACTAGGAGGAACCAGAGCTCGC
CAAGGCCACCAACTCAGCCACCGTCGCGTCCATGTCGCCGAAGAGGGACCACTATCCCCTCTAGCCCAGGCCGTGGGCGTTTATCCGCCGGGCAGACAGA
ACCACATGGGGGAGAGCACGATGGCCATAGGAGGGAACTGGTCATCCATGGCGAAGAGTCACCACCAGAAGGAGAAGCCGCCGCCACCGGGAGCTCCCGA
AGCTCACAACAGCCTGCCCGCCCCCCCACAGACCCAAAACGGCGCGTTCAAAAAGGTAACGACGCTGCCATGGCGCCGCCGCCGCCCAAACCAAAGTTGT
GGGCTTTCACCCGGGTGCAGGGGAAGGGGAGGAGGGGGAGGTGAACCTCAACGCCGCCTTCAGGAAGGAGACGACGAGGTGGCCGCCGCCGCCGCCGGAG
GCCAAGGGGTTACCCCGATCCAGAGCACCCCACTCCACATCCACGCAGCCAACAACCAGATCGGGTCGAACCTAACATAGAGGAGGCTGCTGCAAGCGAC
GGGACACCGTCTTCAGATCTGGTGAAGAGGGACGCGGGGGCCCCAACGCACGACGCCCCAGTCCACCGCCGCCTCGCCGCCCACGCAGCCGAGGGGAGGC
GGCCCCAACTCCGGCGTCCGCCGCCCGCCGTCGGGACGGCGCCGCCCACGCCACCAAGGCCGCCGCCTGGAACCCTAGGTCCGTACCCAGGGAGGAAACG
CGACCGAAGACCTCGCCGCCACCCTCATCGGCGTTCGCACGTGGTTGCCGACGGCTGCCTCCGGCGGCGGCAAGGGGAGAAGCGGAGGAAGGGGGGTGGC
GACGAACGGGATCTGGATCGCCCCCGAGTCGCCCCTGCGGGGCG
page-top