Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21993  (registered. 2012)
Contig Information
Length 1145 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242037343|ref|XP_002466066.1|| hypothetical protein SORBIDRAFT_01g000600 [Sorghum bicolor]
Score 231
Evalue 1.00E-58
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21993
GCGCCGCCCCACCGTCGTCGCCGCCGACCCGAGATCCCCCCCGCCGCCCCCGATTCGTACGGACGGACGGACAGACCGAGGGAGATGCCGGTGGGAGCGG
GCCTGCGCGGGTGATCTCTCTCCCTCCGTCGACAGCACGCGCGTGGGGAGGGGAGGGGAGCCGTCGCGTGGGCAAGCCCGCGTGGAGGGGTCCCGTCCGT
CCCGCGCCCGCCCGGCCCGTCCTAGGGTAGAAGAAGCAGCGGCGGCGGCGGCAGCGGCAGCAGCTCCGCCGCTCTAGGGTTTGCTCGCTCGGCCGATCTC
GTCGTCGCGTGGCGCGACGGCTAGCAGGAGACGGATGTTTTCGCACGGCGCGGATCCCGCCCACGACGCCTCCGCCGCCGGCGGCGGCGTCGGTGTCAGC
GCCGGCGGCCCGCTCGTCCACACCCGCTTCGTCTGGCCCCATGGCGGCAAGAGGGTCTTCCTCAGCGGTTCCTTCACCAGGTGGTCAGAGCATTTGCCGA
TGTCTCCAGTCGAAGGTTGCCCCACTGTATTTCAAGCTATCTGCAGCTTACCTCCAGGGATTTATCAGTACAAGTTCAATGTGGACGGGCAGTGGAGGCA
TGACGAGGGGCAACCTACTATAACGGGAGAGTATGGGGTGGTAAACACTTTGTACTTGACAAGGGAATTTGACCACATAAATACTGTACTGAGCCCCACT
ACACCTGGGAGCAGGATGGATGTGGACAATGATAGTTTTCAACGAATGGTAAGTATCACTTATCTCGCCTAGTTGTGCGTGAACAGCCACACTATGTAGT
CTACCTGTTCTTTTTATAACCGTCCTCTAAGCTTAATTGAAATGTTATGGTGACATATTTGTAAGCATACCTAAATGTATTACCATTTCAGTATTACAGC
CTCTTGGAAAATATTATCTGCACAGGAGACAAGTGTTACTTTATTTCCTTGGATAATTTATAGAAAGCAATACTTGCTCCAATATATCTTGTTATCTGCA
TTCTAAAGTTCATGTACCCATGGAATTGGTGGTTATATGGTAGTTCTCTGCTTTGGGATTCTACTAATTTCTTTGTTGAAGGTAAATAGAATATTTAGTT
ATGGAGCAGGGATGAAATTTACGTAACAATGACCTTGTCGTTACC
page-top