Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21952  (registered. 2012)
Contig Information
Length 805 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_r Root 2
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_OKCS Seed DPA5 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115448085|ref|NP_001047822.1|| Os02g0697700 [Oryza sativa (japonica cultivar-group)]
Score 261
Evalue 5.00E-68
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21952
TGCACAAGAAAAACAGTTTTCCGAAGCTTCGAGCCAGGGCGGTTGGCGGCAGCCGCGGGGACGATGGTCGGGATCTTCTCCAGGTTCTCTTCCGGCGCCG
GCCACCGCCGCGCCAAGAGTGCCGTGGAGGTTGTGGAGACATTGGCGCCCAACATGGAGACCGGGGAGTCTGACCCGGCAGCTGATCCTGGAGATAGCCC
GCACGGCATTGAGGTCGGCATCGAGTTCAAGCCGGTGGAGCACCCTGTGGAGCCTGTCAACCTTGACCAACCAGTGAAATGCCCGCTTCCTGAGCCATCT
ATACTGCATGATGGGAGGATATGGCAAGAGAGGATGTCTACAGCGGGCGGGAGGCCGAGGACGGACCTGCCGGTCGTGAAGGAAGGATTGCAGCTCGAGC
CCGACAGCAGCACCACAAGGTCGAGGTCTGCGGTCCGGAGGCGCGCCATACTGCCCTCCGTGAGCGCCCCTGAGCATAACATCCTGGCGCTGCTTGACGA
GTGCGACGTGCCTGAGAGCCAGCGCCCTGCTGAATGAGCCTGGATGCCGTCTCCACTGTATCTGTACATTGCTGTATCTTCCATCACCGCCGTCGCTACG
AGCTGTGGATACAGCCGTGTTGAATCTCCGGTTGCAACTAGCAACAGCCTTTTGTGTGGATTGTTTCTATATATATGTACACACTTTGCATACGAAGTGA
AAAGAAATCTGCACTTGCATCATCACATTTACTTGTTTAAGACGAAATTGGGTTGGTTGGATTCATTTTGAGCAGCACTGCTGCTATGATCCTTCAAAAA
AAAAA
page-top