Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21899  (registered. 2012)
Contig Information
Length 831 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_CA 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115452915|ref|NP_001050058.1|| Os03g0339100 [Oryza sativa (japonica cultivar-group)]
Score 456
Evalue 2.00E-126
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21899
GAAGTGAGTAGTAGCTCGGAGATCGGCGGGCGGCGGCTATGGCGATGGCGGCGGCATCAGCGGGCGGCGAGCCGGTAGAGCCGCAGTCGTTGAAGAAGCT
GAGTCTCAAGTCGCTGAGACGCTCCCTCGACCTCTTCGCGCCCACCCACTCCCTCCCCTTCGCTCCCGACGCCGAGAGCAAACGGATTCGCGTCAGCTGC
AAGGTGAATGCGGAGTACGGCGCGGTCAAGAACCTGCCGACCGACCAGGACCGAGCGCAGGGGAAGGGCGCCGCCGCTCCTTCCAATGCATTGGCGCTTC
TAGGCACACAAGACACAAAAGATGCTCCTAGGGAAGGCACTAGTAATGCCATTATCCCTGCACCGCTTATGCTTCCTAAAGCACCTGAATCTGCAGTGCC
TGGCAAAAATACAACCGTATTGTCGGTTCCTGGGTCATCTGATAGATTCTCGACATCTGCACTGATGGAAAGGTTGCCAAGTAGATGGCCTAAACCTGTA
TGGCATGCTCCCTGGAAGAACTATCGGGTTATCAGTGGCCACTTGGGCTGGGTGCGATCTATAGCATTTGATCCAGGCAATGAATGGTTCTGTACTGGTT
CTGCTGATAGAACAATAAAGATATGGGACCTGGCATCAGGAATGTTGAAGCTGACACTAACTGGTCATATTGAACAAGTCCGTGGACTTGCTGTCAGTCA
GCGGCACACATATTTATTTTCTGCTGGTGATGACAAACAAGTAAAATGTTGGGATCTTGAACAAAATNNNNNNATTCGGTCTTATCATGGGCATCTGAGT
GGGGTTTACTGCTTAGCTCTCCATCCAACAA
page-top