Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21883  (registered. 2012)
Contig Information
Length 1399 bp
Clones alternative view 65 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 5
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115463787|ref|NP_001055493.1|| Os05g0402300 [Oryza sativa (japonica cultivar-group)]
Score 433
Evalue 2.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21883
TTTTTTTTTTGGTACAAAACGTTCATACGATCACTGATTGTTGGCAGTTTAACAACACTCAGGCACATAAACTCACAATAGAACACCTATACATATGGTT
GTACTTTGGCCTCATCTCTGGATGATGGCAAAAACTTACTACCATGTCTTCCAAGTTATGTAGATAGCAATTCAAAAGACTTGATAAATGTTGGACATAT
GCCTGGGTTGGCACAAGGTCCTGGTGGTTCAGACAGGACCCATCAGTTGTCATTCTGCCTGAGCATCTGTAGGATGGTCAGGAACAGGTTGAGGATGTCG
AGGTAAAGCTCAACAGACGCCCAGATGTACTCGTCATAAGTGTGGCGCTTTATCAAGTTCTCAGTGTCGTAGACGATGAAGCCTGAGAAGACTAGAGCTC
CAAACCCACCGATCACAGCATTCGATGCAGGTCCAAATGGGAAGAAGATCTGGGTAAAGCTTATCACGACCAGGATGGTGAGAGCAGAAAACAGAAACGG
TCCAAGGTAACTAAATTCCTTGCCCTTCTTTGCGGCCCAGAATGTGTATGCAGTCAGAGAGACAACCACAGCTGAGGTCAGTACCAATGCTTGAAGCACA
ATAGTTCCTTCAGTGTTTGCACAAGCCACACCAATGCTGAAGCTCAAGCACAGAGTGAACAAACCCAAGATAGCAAGATTGTGAGGGTGTCTGTGCTGAT
AGATGTACAATGGGATCATCAGGATGAAGGGGAGGACGGCGAGCACGAGCGCGAGGACGGGCGAGTTGGAGAGCGTGGCGTTGAGGGTGGGGTAGAAGAC
GGTGATGGCGGAGACGACGGTGGTGAGGACCAGCTGCGCGCAGAGGATGCCGTAGACCTTGCGGATGAAGCCCCAGCGGAGGGCGTTCTCCCCGCGCGAG
ATCCCCGGGTAGAGCGTCTCCCCGTTCCCCGCCTCCAGGTCGATCGACGACGCCTCCACCTTCTCCTTCATCTCCGGCGCCCGGCGGTAGCCCGACGGTG
CCAGCGGCTGCATCTCCGTCGCCGACGCCATCTCTCTCACCGACGCTGTCGGTGGTGGGGAATTGGGGATTTTCGCCTCGTGCCGAATTCGGCACGAGGA
TCAAGCTCAGTGCTGAGAAGGCGATCTTCATCTTTGTGAAGAACACTCTTCCACCGACAGCTGCCCTGATGTCTGCCATTTACGAGGAGAACAAGGACGA
GGATGGCTTCCTCNACATGACCTACAGCGGTGAGAACACCTTCGGATTGCTCTAGATGGCGCTGGCTGCCACGGCAATCGCTCTGAATGCCTCCTGTAAA
TAAGGCGTGCCAATCAACTGTGTATATATTCCGGTTTGCCTCGTCGTAGGATCTTTAAATTGCACAACCAAGAAAAACCTATTCGTATCCTGACTTATC
page-top