Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21802  (registered. 2012)
Contig Information
Length 1099 bp
Clones alternative view 69 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 10
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 8
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115458738|ref|NP_001052969.1|| Os04g0457000 [Oryza sativa (japonica cultivar-group)]
Score 468
Evalue 6.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21802
TTTTTTTTTTTTTTTTGGTGATGAATCAAATGCCCTTGCTCATTCTGCCTTAAATTACAGAGCTCAGACTATATATATTACATGGTACATACGCTGGAGA
AAGAAAGAGTACTTGATTCCCCATTCGATTCACACACACCACCCGAAAGAAGTCACGGACACAGATACGTTGCTGCTGCTTCTTCGACCTCCAGCAGATC
CCATCAATCCATGCGTCCGATCTGATGCAATGCAACAACCCCTCTCCCACCACGCGCGCAAGCCAAAAAATCGTCTTATAGGCCGAGCGCGCCGAGCGGC
GTCTTGCCCTGCCCGGCCTCGAAGTAGAAGATGAGCATGGCAAGCATGGCGAGGCGCGAGTGCTTGATCTCGGCCACCTTGAGCCGCTCGAGCTTCTCGG
TGTCGGGGATGTAGACGCCGTCCTTGGTCTCGCCACCGAGGCCGAGCGGGTCGAAGAACTTGCCGCCCGGGTACCCTTGCTCGCCGGTGAAGTTGGCGAA
GTTCTCGGCTGTGCGCGACCACGGCGTGGCCCACTCCACCGACTGGGAGTCCGGGTTGAAGAAGTCGACCCACCGCTTGGACTCCACCCACCCCATGAGC
AGCAGCTGGGTGCCCAGGAGCGACCCGAAGGAGAAGGGCGCCACCGCGCCAGGCTGCGCTCCGGCCTCGAACCACGGCACGCCGCTGTACGCCTGCCCGA
TGAAGATGCCCAGCACCGCGGCCATCGCCCAGCGCCCGTGGATCAGCTCGGCCTCCCTGTACCACTTGAGGAACGCCGGGTCCTTGCCAAGCCCCAGCGG
GTCGAAGCCGAAGTCACCGGGGAGCGAGCCATCGAGCCAGGACGGGTTGATGAACTCGGCATCGCTCTTGACCGCGGGGATCCACGACTTCTTGCCGACG
GCCGCGGCGACGACCACCACGCGGCGCGTCACGGGCTTGGCGGCGCCGAGGGAGGCGGCATTGGCGAGCGCGCGCCTCGCGCCGAGGAACGGGTTCTTGA
GCACGGCCGCGGAGGCGGTGGCGGAGGTGGAGGCGAGCGCCATGGGTGCCGGTGTTGCTTCGCCGGTGTGACGGTGAGGTCCCTGACGCGCGCGGCGGA
page-top