Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig218  (registered. 2012)
Contig Information
Length 1143 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 1
Wh_SHC Shoot grown with cold treatment 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|143454263|sp|Q5N7W4.2|RH30_ORYSJ|RH30_ORYSJ RecName: Full=DEAD-box ATP-dependent RNA helicase 30
Score 516
Evalue 1.00E-144
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig218
GGCCGGTTGATAGATATGCTGGAAGCTGGTCACACAAACCTACGTCGGGTTACATACCTTGTCCTGGATGAGGCAGATCGTATGCTCGATATGGGTTTTG
AACCTCAGATTCGAAAAATATTGGCACAAATCCGTCCGGACAGACAAACCTTGTACTGGAGTGCCACGTGGCCGAGAGAAGTTGAAACGCTGGCTAGACA
ATTTCTACAAAACCCTTACAAGGTAATGATAGGAACAGCTGAACTTAAAGCTAACCATTCCATACAGCAAATTGTTGAAGTTATCTCGGATCATGAAAAA
TATCCCAGGCTAAGTAAACTTTTATCTGATCTGATGGACGGGAGCCGAATCTTGATATTTTTTCAAACAAAAAAGGAATGTGATAAGGTCACTCGGCAAC
TTAGAATGGACGGATGGCCAGCATTATCTATACATGGTGATAAAGCTCAGTCTGAAAGGGACTATGTTCTGGCAGAGTTTAAGAATGGGAAGAGTCCTAT
AATGGCTGCCACAGATGTAGCGGCACGTGGTCTTGATGTGAAGGATATTAAGTGTGTGATTAATTTTGATTTCCCGACAACTATCGAGGATTATATTCAT
AGGATAGGTCGCACTGGCCGTGCCGGTGCTACCGGGATGGCATTCACGTTCTTCACACATTCCAATGCAAAATATTCAAGGAATCTCGTTAAGATCTTGC
GCGAAGCTGGGCAGGTTGTGAATCCAGCGTTAGAAGCTATGTCCAAGTCTGCTGGTTCTATGGGAGGAGGAGGTAATTTCCGGTCAAGGGGCCGAGGTGG
GTTTGGTGGTGGTGGGTATGGTGGTAACCGTTCTGGATCAAATTCCATTCCAGTACGTAGAAGATACTAAGACACAAACATGAAGGTCAATTCTGATGCT
GGAAAAGACAGAGCGATGAAGTTTTATCTGTATACATTAGGCATTAAATTAAATGCATTTTTGGGGAATTTCTTTGAAATCCTTCTACTGTTAGAAGATC
AAAACAAAAGTCATTCTTGATATTTTTGTACCGGAGCTCAAATGGAAGGAACTCATGTATCAGCGACCTTGGAGATTAGAATAGTCTTGTCGAAACAGTG
AACTAAGCGTGTATCTTTGTGGCTAATTGTCTAATTGGATTTG
page-top