Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21726  (registered. 2012)
Contig Information
Length 800 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242037443|ref|XP_002466116.1|| hypothetical protein SORBIDRAFT_01g001620 [Sorghum bicolor]
Score 202
Evalue 4.00E-50
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21726
TTTGCGACAAGAAGTTTCCTTTTTTCCCCCTCAAATGTACTTGTACACTTGTATTACAACTGGTCCGTTTAACGAACACTGAAGTCTATACCCAGAGTAC
AACAGCTTAAACTACAGCCCCTAAAAACTCCAGATCCCACAGGCCACATGAATGTTCATCTCTATGCAGCCTTTACCTGGGACTGCGGAAATGACGCCCC
CAAAGTTTCTCACACAGGAATATACTATAAACTGAATCTATACGCGAAGGTGGCTTGGTGTATCTAGACTCTAGATTTGTCCCAGTATCTGCTTCCTGCT
TTGCTACCTCCACACGCAGCCATTGTTCATCTTTTGGATGTGGCGGCATGCCATGCAACAACCACCCGCTGTTACTGTCGGTTTCATCCGAGTTATCAGC
GACGCGTGTATTTTAATTGTAATCTATACTTGATCTGATGACATTTCATTCTTTCTCGGCTATAGCAACAAAAACATCCTTGGGTGACCACCTTCTCCTT
GAAGCTTTGTCTGGTGGATTGATTATGGCACGCTCGGCGTCCTCAAGACGGTACCCGATGACAACCTCTTTCCTCTGCCTAGCTCGTAGCATGACCTCGA
AGAAGCTTAGCTCCTCGTCTTCTCGAAGGTACAGGTCAGATTGTCGTATTTGCAGTTCATTCCCCTGTTCAGCAAAGAGCTCCTCCAAGACATAATTTAT
TTGGCGATCTTCTGCAACCATTGCCAATGCCATGCTCACGAGTTCATTTGAAAGAACATAGTCGCTTATTTTTGACATGTATAATAAATTTTTAGTCCTA
page-top